Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638361_at:

>probe:Drosophila_2:1638361_at:413:99; Interrogation_Position=1036; Antisense; AGATGAAGCGCATTGCCGCTGCATT
>probe:Drosophila_2:1638361_at:389:51; Interrogation_Position=1066; Antisense; ATGCTGCCGCTGATGTCTATGGTTC
>probe:Drosophila_2:1638361_at:494:679; Interrogation_Position=1083; Antisense; TATGGTTCCACCTTCACCTATGGAG
>probe:Drosophila_2:1638361_at:708:517; Interrogation_Position=1111; Antisense; GTGGTCTGCTTAACTATGTCGTTTC
>probe:Drosophila_2:1638361_at:301:61; Interrogation_Position=1126; Antisense; ATGTCGTTTCGGGAGCTGCCAAGGA
>probe:Drosophila_2:1638361_at:652:585; Interrogation_Position=1192; Antisense; TGGAACTGCGTGACAAGGGCACCTT
>probe:Drosophila_2:1638361_at:205:435; Interrogation_Position=1260; Antisense; GAGGTCACCGCTGGTCTTAAGGCTC
>probe:Drosophila_2:1638361_at:666:709; Interrogation_Position=1276; Antisense; TTAAGGCTCTGGTCAACAAGGCTGC
>probe:Drosophila_2:1638361_at:451:319; Interrogation_Position=1299; Antisense; GCCGAGGAGGGCATTTTTGACTAGA
>probe:Drosophila_2:1638361_at:370:539; Interrogation_Position=1328; Antisense; GGTATGTACCAACTTGGGCGCAGAT
>probe:Drosophila_2:1638361_at:648:453; Interrogation_Position=899; Antisense; GATCATCTCGCTGCAGAACTTTGTG
>probe:Drosophila_2:1638361_at:700:417; Interrogation_Position=923; Antisense; GAGCTCCTTCGAGGATGGCTACATC
>probe:Drosophila_2:1638361_at:673:67; Interrogation_Position=937; Antisense; ATGGCTACATCCGATCGTACATGGC
>probe:Drosophila_2:1638361_at:248:279; Interrogation_Position=962; Antisense; CTACCATGCCTACGGACAGTATGTC

Paste this into a BLAST search page for me
AGATGAAGCGCATTGCCGCTGCATTATGCTGCCGCTGATGTCTATGGTTCTATGGTTCCACCTTCACCTATGGAGGTGGTCTGCTTAACTATGTCGTTTCATGTCGTTTCGGGAGCTGCCAAGGATGGAACTGCGTGACAAGGGCACCTTGAGGTCACCGCTGGTCTTAAGGCTCTTAAGGCTCTGGTCAACAAGGCTGCGCCGAGGAGGGCATTTTTGACTAGAGGTATGTACCAACTTGGGCGCAGATGATCATCTCGCTGCAGAACTTTGTGGAGCTCCTTCGAGGATGGCTACATCATGGCTACATCCGATCGTACATGGCCTACCATGCCTACGGACAGTATGTC

Full Affymetrix probeset data:

Annotations for 1638361_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime