Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638365_at:

>probe:Drosophila_2:1638365_at:232:235; Interrogation_Position=1000; Antisense; AATCCACAATACTGCTTTCATCACA
>probe:Drosophila_2:1638365_at:696:703; Interrogation_Position=1027; Antisense; TTAGCACCCAGCACTTAGTCTCACT
>probe:Drosophila_2:1638365_at:520:389; Interrogation_Position=1072; Antisense; GAAACTGCCAATTTTACGCGTAGAA
>probe:Drosophila_2:1638365_at:146:135; Interrogation_Position=1087; Antisense; ACGCGTAGAATTCTATTCCGTTGTA
>probe:Drosophila_2:1638365_at:686:87; Interrogation_Position=1120; Antisense; AGTCGTTTTCAGATCGCACCTTAAA
>probe:Drosophila_2:1638365_at:696:161; Interrogation_Position=1162; Antisense; AAATTGCAAGTGTTTCGCTCTGACC
>probe:Drosophila_2:1638365_at:427:133; Interrogation_Position=1184; Antisense; ACCCACTGTCTGTCATTCAAGCAAG
>probe:Drosophila_2:1638365_at:647:423; Interrogation_Position=1238; Antisense; GAGACACTCATGTTTTGTCCACAAA
>probe:Drosophila_2:1638365_at:61:137; Interrogation_Position=736; Antisense; ACGAGAAGCCCGTCATCTGTGAGGA
>probe:Drosophila_2:1638365_at:137:161; Interrogation_Position=760; Antisense; ACAACGAGGAGCTGCTGCGCTATGT
>probe:Drosophila_2:1638365_at:467:63; Interrogation_Position=781; Antisense; ATGTGGCGGCCACGAATCCCGGCAT
>probe:Drosophila_2:1638365_at:513:45; Interrogation_Position=796; Antisense; ATCCCGGCATCCGTCTATAGAGCGG
>probe:Drosophila_2:1638365_at:357:327; Interrogation_Position=829; Antisense; GCGTTCGCTGTTTGCCTAATTTTAA
>probe:Drosophila_2:1638365_at:696:649; Interrogation_Position=955; Antisense; TACAATTTCCGATCCTACAAACACC

Paste this into a BLAST search page for me
AATCCACAATACTGCTTTCATCACATTAGCACCCAGCACTTAGTCTCACTGAAACTGCCAATTTTACGCGTAGAAACGCGTAGAATTCTATTCCGTTGTAAGTCGTTTTCAGATCGCACCTTAAAAAATTGCAAGTGTTTCGCTCTGACCACCCACTGTCTGTCATTCAAGCAAGGAGACACTCATGTTTTGTCCACAAAACGAGAAGCCCGTCATCTGTGAGGAACAACGAGGAGCTGCTGCGCTATGTATGTGGCGGCCACGAATCCCGGCATATCCCGGCATCCGTCTATAGAGCGGGCGTTCGCTGTTTGCCTAATTTTAATACAATTTCCGATCCTACAAACACC

Full Affymetrix probeset data:

Annotations for 1638365_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime