FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638367_at:

>probe:Drosophila_2:1638367_at:142:537; Interrogation_Position=1085; Antisense; GGTCGACGACCCTAAGCAGAAGAAG
>probe:Drosophila_2:1638367_at:96:221; Interrogation_Position=1107; Antisense; AAGTGGGACTGCGAGTCTATCCTGT
>probe:Drosophila_2:1638367_at:655:503; Interrogation_Position=1130; Antisense; GTCCACCTACTCGAATATCTACAAT
>probe:Drosophila_2:1638367_at:702:363; Interrogation_Position=1142; Antisense; GAATATCTACAATCACCCGAAGGTG
>probe:Drosophila_2:1638367_at:88:195; Interrogation_Position=1282; Antisense; AACTGACAGCCAAGGCGCTTGCTAA
>probe:Drosophila_2:1638367_at:411:653; Interrogation_Position=1304; Antisense; TAATTTGGCCGATGAATCACCCGCT
>probe:Drosophila_2:1638367_at:382:595; Interrogation_Position=1334; Antisense; TGGGCCGAAGTCACTGTGCGCCAAA
>probe:Drosophila_2:1638367_at:710:533; Interrogation_Position=1361; Antisense; GGTGCTCTCCACATTAAGCGTTCTG
>probe:Drosophila_2:1638367_at:213:207; Interrogation_Position=1376; Antisense; AAGCGTTCTGTCCATTAGACCCAAG
>probe:Drosophila_2:1638367_at:537:675; Interrogation_Position=1391; Antisense; TAGACCCAAGGACGAGACCCACGAA
>probe:Drosophila_2:1638367_at:285:75; Interrogation_Position=1444; Antisense; AGGACTATCGCAACGAGCGTCGCAT
>probe:Drosophila_2:1638367_at:84:83; Interrogation_Position=1552; Antisense; AGGGAGCCTCCATTGTCTAGCTTAA
>probe:Drosophila_2:1638367_at:120:499; Interrogation_Position=1566; Antisense; GTCTAGCTTAAGTTTCCGGCTCTGT
>probe:Drosophila_2:1638367_at:586:571; Interrogation_Position=1583; Antisense; GGCTCTGTTCTCTAGGCTTAAATGT

Paste this into a BLAST search page for me
GGTCGACGACCCTAAGCAGAAGAAGAAGTGGGACTGCGAGTCTATCCTGTGTCCACCTACTCGAATATCTACAATGAATATCTACAATCACCCGAAGGTGAACTGACAGCCAAGGCGCTTGCTAATAATTTGGCCGATGAATCACCCGCTTGGGCCGAAGTCACTGTGCGCCAAAGGTGCTCTCCACATTAAGCGTTCTGAAGCGTTCTGTCCATTAGACCCAAGTAGACCCAAGGACGAGACCCACGAAAGGACTATCGCAACGAGCGTCGCATAGGGAGCCTCCATTGTCTAGCTTAAGTCTAGCTTAAGTTTCCGGCTCTGTGGCTCTGTTCTCTAGGCTTAAATGT

Full Affymetrix probeset data:

Annotations for 1638367_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720