FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638368_at:

>probe:Drosophila_2:1638368_at:421:205; Interrogation_Position=541; Antisense; AAGCGCATGTTATATACCACCCGGA
>probe:Drosophila_2:1638368_at:370:131; Interrogation_Position=559; Antisense; ACCCGGAATCGCGTTAGCCAGGATA
>probe:Drosophila_2:1638368_at:431:85; Interrogation_Position=637; Antisense; AGTGATTTCCTCATCATTGCATCCC
>probe:Drosophila_2:1638368_at:364:7; Interrogation_Position=652; Antisense; ATTGCATCCCCATTGACCAAGGAGA
>probe:Drosophila_2:1638368_at:109:541; Interrogation_Position=682; Antisense; GGATTGTTTAATGCCACCGTCTTTA
>probe:Drosophila_2:1638368_at:596:141; Interrogation_Position=721; Antisense; ACGGCAGTACTGGTCAACGTTGGCA
>probe:Drosophila_2:1638368_at:475:97; Interrogation_Position=765; Antisense; AGATGATCTTTACGAGGCGCTTAAA
>probe:Drosophila_2:1638368_at:153:201; Interrogation_Position=793; Antisense; AACCGAATTTTTGCTGCTGGACTAG
>probe:Drosophila_2:1638368_at:382:677; Interrogation_Position=815; Antisense; TAGATGTTATGGATCCGGAGCCCCT
>probe:Drosophila_2:1638368_at:288:397; Interrogation_Position=868; Antisense; GACAATGTTGTGGTTACTCCTCATG
>probe:Drosophila_2:1638368_at:383:475; Interrogation_Position=880; Antisense; GTTACTCCTCATGTGGGCTATGCCA
>probe:Drosophila_2:1638368_at:278:551; Interrogation_Position=908; Antisense; GGAGAACCCGTGTTGATGCAGCCAA
>probe:Drosophila_2:1638368_at:714:19; Interrogation_Position=932; Antisense; ATTTGGCTTCGCGTAATGTGCTCAA
>probe:Drosophila_2:1638368_at:295:567; Interrogation_Position=963; Antisense; GGCAGGAGAGCCGATGTTGTCACCC

Paste this into a BLAST search page for me
AAGCGCATGTTATATACCACCCGGAACCCGGAATCGCGTTAGCCAGGATAAGTGATTTCCTCATCATTGCATCCCATTGCATCCCCATTGACCAAGGAGAGGATTGTTTAATGCCACCGTCTTTAACGGCAGTACTGGTCAACGTTGGCAAGATGATCTTTACGAGGCGCTTAAAAACCGAATTTTTGCTGCTGGACTAGTAGATGTTATGGATCCGGAGCCCCTGACAATGTTGTGGTTACTCCTCATGGTTACTCCTCATGTGGGCTATGCCAGGAGAACCCGTGTTGATGCAGCCAAATTTGGCTTCGCGTAATGTGCTCAAGGCAGGAGAGCCGATGTTGTCACCC

Full Affymetrix probeset data:

Annotations for 1638368_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720