FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638371_at:

>probe:Drosophila_2:1638371_at:629:145; Interrogation_Position=1617; Antisense; ACTACGCCTGCCGAAGTTTGACTTG
>probe:Drosophila_2:1638371_at:92:693; Interrogation_Position=1633; Antisense; TTTGACTTGGGCATGGCAGCCTATC
>probe:Drosophila_2:1638371_at:691:567; Interrogation_Position=1647; Antisense; GGCAGCCTATCGAACCAGCATAAAC
>probe:Drosophila_2:1638371_at:389:25; Interrogation_Position=1690; Antisense; ATATGTGCCTGCTTTTGAATCCCCA
>probe:Drosophila_2:1638371_at:636:365; Interrogation_Position=1706; Antisense; GAATCCCCATCAAAGTCTAACAATC
>probe:Drosophila_2:1638371_at:267:37; Interrogation_Position=1739; Antisense; ATCATATCATACTCTGCCTAATCCA
>probe:Drosophila_2:1638371_at:568:641; Interrogation_Position=1751; Antisense; TCTGCCTAATCCACTCATGCGAATG
>probe:Drosophila_2:1638371_at:386:51; Interrogation_Position=1767; Antisense; ATGCGAATGCCCTTCTGTGTTTTTG
>probe:Drosophila_2:1638371_at:181:511; Interrogation_Position=1783; Antisense; GTGTTTTTGGCCAGGTGAATTCCAA
>probe:Drosophila_2:1638371_at:128:679; Interrogation_Position=1811; Antisense; TAGTATCTCAGCAGACAGGACAGAC
>probe:Drosophila_2:1638371_at:62:105; Interrogation_Position=1836; Antisense; AGACCCGCCATCTGTGATAAGAAAA
>probe:Drosophila_2:1638371_at:200:373; Interrogation_Position=1890; Antisense; GAAGTCGATGCAACCAACTGAGAGA
>probe:Drosophila_2:1638371_at:79:63; Interrogation_Position=1945; Antisense; ATGGGTTGATCGCAATTTAGCATTA
>probe:Drosophila_2:1638371_at:277:413; Interrogation_Position=2156; Antisense; GACCTTCCAGATCAATTCAGTATTT

Paste this into a BLAST search page for me
ACTACGCCTGCCGAAGTTTGACTTGTTTGACTTGGGCATGGCAGCCTATCGGCAGCCTATCGAACCAGCATAAACATATGTGCCTGCTTTTGAATCCCCAGAATCCCCATCAAAGTCTAACAATCATCATATCATACTCTGCCTAATCCATCTGCCTAATCCACTCATGCGAATGATGCGAATGCCCTTCTGTGTTTTTGGTGTTTTTGGCCAGGTGAATTCCAATAGTATCTCAGCAGACAGGACAGACAGACCCGCCATCTGTGATAAGAAAAGAAGTCGATGCAACCAACTGAGAGAATGGGTTGATCGCAATTTAGCATTAGACCTTCCAGATCAATTCAGTATTT

Full Affymetrix probeset data:

Annotations for 1638371_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720