FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638372_at:

>probe:Drosophila_2:1638372_at:85:409; Interrogation_Position=268; Antisense; GACGTGTTCATTATTCCGCGGATTA
>probe:Drosophila_2:1638372_at:192:109; Interrogation_Position=311; Antisense; AGAAGGTTTCGCTCATGGGACACTC
>probe:Drosophila_2:1638372_at:227:593; Interrogation_Position=338; Antisense; TGGGCGCCTTCTACAGTTTTATTTA
>probe:Drosophila_2:1638372_at:325:703; Interrogation_Position=356; Antisense; TTATTTACGCGACAATGGCACCCGA
>probe:Drosophila_2:1638372_at:464:285; Interrogation_Position=408; Antisense; CTGTGTGCTGATGCCGAAGTTCGAC
>probe:Drosophila_2:1638372_at:675:373; Interrogation_Position=423; Antisense; GAAGTTCGACAGTGACATTGCTCTC
>probe:Drosophila_2:1638372_at:239:165; Interrogation_Position=449; Antisense; AAAGCTTCCGCAGAAACCTGGACCA
>probe:Drosophila_2:1638372_at:199:191; Interrogation_Position=547; Antisense; AACTACTGGGACATTGGTGCGGAAC
>probe:Drosophila_2:1638372_at:323:527; Interrogation_Position=598; Antisense; GGGAAGAAGCCCTTTCTCATTATCA
>probe:Drosophila_2:1638372_at:422:697; Interrogation_Position=640; Antisense; TTTCTGGGCGCTCACAGTGACGAAG
>probe:Drosophila_2:1638372_at:408:83; Interrogation_Position=655; Antisense; AGTGACGAAGCCGTTTCCATTTTGG
>probe:Drosophila_2:1638372_at:186:515; Interrogation_Position=756; Antisense; GTGTGCGAAGTACATGTGTCCCTTT
>probe:Drosophila_2:1638372_at:551:513; Interrogation_Position=771; Antisense; GTGTCCCTTTATTCAGTACCATCGA
>probe:Drosophila_2:1638372_at:666:129; Interrogation_Position=798; Antisense; ACCGATGGGAGCAACTCTGTTCCAA

Paste this into a BLAST search page for me
GACGTGTTCATTATTCCGCGGATTAAGAAGGTTTCGCTCATGGGACACTCTGGGCGCCTTCTACAGTTTTATTTATTATTTACGCGACAATGGCACCCGACTGTGTGCTGATGCCGAAGTTCGACGAAGTTCGACAGTGACATTGCTCTCAAAGCTTCCGCAGAAACCTGGACCAAACTACTGGGACATTGGTGCGGAACGGGAAGAAGCCCTTTCTCATTATCATTTCTGGGCGCTCACAGTGACGAAGAGTGACGAAGCCGTTTCCATTTTGGGTGTGCGAAGTACATGTGTCCCTTTGTGTCCCTTTATTCAGTACCATCGAACCGATGGGAGCAACTCTGTTCCAA

Full Affymetrix probeset data:

Annotations for 1638372_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720