FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638373_at:

>probe:Drosophila_2:1638373_at:546:331; Interrogation_Position=235; Antisense; GCGGCATGGCCGAGATCTGTTTTTT
>probe:Drosophila_2:1638373_at:253:549; Interrogation_Position=289; Antisense; GGAGTACATGCTATCTGCAGTCGTA
>probe:Drosophila_2:1638373_at:689:349; Interrogation_Position=305; Antisense; GCAGTCGTATTGATGGCCAGCGTTA
>probe:Drosophila_2:1638373_at:461:517; Interrogation_Position=343; Antisense; GTGTGTGGATGGCTTTATCTTCTCT
>probe:Drosophila_2:1638373_at:45:715; Interrogation_Position=362; Antisense; TTCTCTGCCTTGGTTCAGCGGAAAA
>probe:Drosophila_2:1638373_at:88:457; Interrogation_Position=398; Antisense; GATATGCCGCGACAGTATTTTGAAG
>probe:Drosophila_2:1638373_at:387:613; Interrogation_Position=418; Antisense; TGAAGATCGTTACCGCAGATTCGTC
>probe:Drosophila_2:1638373_at:427:95; Interrogation_Position=434; Antisense; AGATTCGTCTTCATGCGGCTGGTCA
>probe:Drosophila_2:1638373_at:679:389; Interrogation_Position=509; Antisense; GAAAGAATGATGACGCCACTCGCCA
>probe:Drosophila_2:1638373_at:466:237; Interrogation_Position=568; Antisense; AATCGATGAGTTTCGCACAGCGGTG
>probe:Drosophila_2:1638373_at:326:669; Interrogation_Position=600; Antisense; TACTGTGGCCCAATCGATCCGATGT
>probe:Drosophila_2:1638373_at:245:693; Interrogation_Position=638; Antisense; TTTGTCCTCTTCCACATAAGCGAAT
>probe:Drosophila_2:1638373_at:224:499; Interrogation_Position=670; Antisense; GTCGGATCTGACACTTCAAGGCTAC
>probe:Drosophila_2:1638373_at:475:503; Interrogation_Position=724; Antisense; GTCCAATTCCCGTCTTAGTCAAATG

Paste this into a BLAST search page for me
GCGGCATGGCCGAGATCTGTTTTTTGGAGTACATGCTATCTGCAGTCGTAGCAGTCGTATTGATGGCCAGCGTTAGTGTGTGGATGGCTTTATCTTCTCTTTCTCTGCCTTGGTTCAGCGGAAAAGATATGCCGCGACAGTATTTTGAAGTGAAGATCGTTACCGCAGATTCGTCAGATTCGTCTTCATGCGGCTGGTCAGAAAGAATGATGACGCCACTCGCCAAATCGATGAGTTTCGCACAGCGGTGTACTGTGGCCCAATCGATCCGATGTTTTGTCCTCTTCCACATAAGCGAATGTCGGATCTGACACTTCAAGGCTACGTCCAATTCCCGTCTTAGTCAAATG

Full Affymetrix probeset data:

Annotations for 1638373_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720