FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638374_at:

>probe:Drosophila_2:1638374_at:323:605; Interrogation_Position=175; Antisense; TGATCGAGCCCTTTGGCGACGCCTG
>probe:Drosophila_2:1638374_at:136:313; Interrogation_Position=203; Antisense; GCCAAAGCCGTCGAGGGAGAACATC
>probe:Drosophila_2:1638374_at:327:115; Interrogation_Position=295; Antisense; AGCAGTTCGAGCTGATGCCCGAGGA
>probe:Drosophila_2:1638374_at:497:447; Interrogation_Position=308; Antisense; GATGCCCGAGGATCAGTTGCAGTAT
>probe:Drosophila_2:1638374_at:443:57; Interrogation_Position=363; Antisense; ATGATGTTCCCGGATCGCGAGGACG
>probe:Drosophila_2:1638374_at:236:75; Interrogation_Position=382; Antisense; AGGACGACGGCAGGCGCATCGTCAA
>probe:Drosophila_2:1638374_at:724:493; Interrogation_Position=402; Antisense; GTCAAGACCTGCAACGAGGAGCTAA
>probe:Drosophila_2:1638374_at:657:115; Interrogation_Position=433; Antisense; AGCAGGACAAGTGCGAGGCAGCCCA
>probe:Drosophila_2:1638374_at:286:125; Interrogation_Position=452; Antisense; AGCCCACGGGATCGCTATGTGCATG
>probe:Drosophila_2:1638374_at:653:681; Interrogation_Position=467; Antisense; TATGTGCATGCTGCGCGAGATGCGC
>probe:Drosophila_2:1638374_at:624:325; Interrogation_Position=481; Antisense; GCGAGATGCGCTCTTCGGGCTTCAA
>probe:Drosophila_2:1638374_at:702:523; Interrogation_Position=497; Antisense; GGGCTTCAAGATTCCCGAGATCAAG
>probe:Drosophila_2:1638374_at:447:369; Interrogation_Position=522; Antisense; GAATGAGGCCATGGAGCTGCTCGCT
>probe:Drosophila_2:1638374_at:543:97; Interrogation_Position=70; Antisense; AGATGACGAACCTTCTGCTAGCAGT

Paste this into a BLAST search page for me
TGATCGAGCCCTTTGGCGACGCCTGGCCAAAGCCGTCGAGGGAGAACATCAGCAGTTCGAGCTGATGCCCGAGGAGATGCCCGAGGATCAGTTGCAGTATATGATGTTCCCGGATCGCGAGGACGAGGACGACGGCAGGCGCATCGTCAAGTCAAGACCTGCAACGAGGAGCTAAAGCAGGACAAGTGCGAGGCAGCCCAAGCCCACGGGATCGCTATGTGCATGTATGTGCATGCTGCGCGAGATGCGCGCGAGATGCGCTCTTCGGGCTTCAAGGGCTTCAAGATTCCCGAGATCAAGGAATGAGGCCATGGAGCTGCTCGCTAGATGACGAACCTTCTGCTAGCAGT

Full Affymetrix probeset data:

Annotations for 1638374_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720