FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638376_at:

>probe:Drosophila_2:1638376_at:574:383; Interrogation_Position=1001; Antisense; GAACTATTGAAACGGTCCCTCGACT
>probe:Drosophila_2:1638376_at:148:405; Interrogation_Position=1022; Antisense; GACTCTTGGCTAGCCCAAAGGACAA
>probe:Drosophila_2:1638376_at:243:545; Interrogation_Position=1054; Antisense; GGATACTACGGCCAATCAATGATTG
>probe:Drosophila_2:1638376_at:456:31; Interrogation_Position=1083; Antisense; ATAATTATTGCACATTTCCCCATCC
>probe:Drosophila_2:1638376_at:648:47; Interrogation_Position=1104; Antisense; ATCCACATGTCTCTTGGCGGTCGTA
>probe:Drosophila_2:1638376_at:417:719; Interrogation_Position=1117; Antisense; TTGGCGGTCGTACATGTCACTCAGG
>probe:Drosophila_2:1638376_at:176:61; Interrogation_Position=1130; Antisense; ATGTCACTCAGGTTCATCGAAAGCA
>probe:Drosophila_2:1638376_at:657:295; Interrogation_Position=1156; Antisense; CGAAGATTATGCCTGCTAAAGAGCT
>probe:Drosophila_2:1638376_at:220:145; Interrogation_Position=685; Antisense; ACTCCGACTGGAGCCGCAATGGTCA
>probe:Drosophila_2:1638376_at:166:451; Interrogation_Position=723; Antisense; GATCTGGCCTACAACCACTATGGTC
>probe:Drosophila_2:1638376_at:556:37; Interrogation_Position=813; Antisense; ATCTTTCACCTGCTATATCTTATCC
>probe:Drosophila_2:1638376_at:201:23; Interrogation_Position=827; Antisense; ATATCTTATCCTACCAAAGCGTCTC
>probe:Drosophila_2:1638376_at:84:685; Interrogation_Position=894; Antisense; TATCCCTCTAAGACTTTCCTGAAGA
>probe:Drosophila_2:1638376_at:47:93; Interrogation_Position=958; Antisense; AGTTAGTTAGCTGCGACATACCAAA

Paste this into a BLAST search page for me
GAACTATTGAAACGGTCCCTCGACTGACTCTTGGCTAGCCCAAAGGACAAGGATACTACGGCCAATCAATGATTGATAATTATTGCACATTTCCCCATCCATCCACATGTCTCTTGGCGGTCGTATTGGCGGTCGTACATGTCACTCAGGATGTCACTCAGGTTCATCGAAAGCACGAAGATTATGCCTGCTAAAGAGCTACTCCGACTGGAGCCGCAATGGTCAGATCTGGCCTACAACCACTATGGTCATCTTTCACCTGCTATATCTTATCCATATCTTATCCTACCAAAGCGTCTCTATCCCTCTAAGACTTTCCTGAAGAAGTTAGTTAGCTGCGACATACCAAA

Full Affymetrix probeset data:

Annotations for 1638376_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720