Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638377_x_at:

>probe:Drosophila_2:1638377_x_at:503:545; Interrogation_Position=184; Antisense; GGATCCATCTACTCCAGCAACGTCA
>probe:Drosophila_2:1638377_x_at:723:37; Interrogation_Position=190; Antisense; ATCTACTCCAGCAACGTCATCGTGA
>probe:Drosophila_2:1638377_x_at:468:117; Interrogation_Position=274; Antisense; AGCTACTGGAGCTCCGGCGGTGTCA
>probe:Drosophila_2:1638377_x_at:400:575; Interrogation_Position=289; Antisense; GGCGGTGTCACCTTCTCTGTGTCCT
>probe:Drosophila_2:1638377_x_at:506:275; Interrogation_Position=300; Antisense; CTTCTCTGTGTCCTCCTTCAAGAAC
>probe:Drosophila_2:1638377_x_at:148:597; Interrogation_Position=306; Antisense; TGTGTCCTCCTTCAAGAACCACGAG
>probe:Drosophila_2:1638377_x_at:621:537; Interrogation_Position=351; Antisense; GGTCAACGACATTGCCATCATCAAG
>probe:Drosophila_2:1638377_x_at:443:149; Interrogation_Position=359; Antisense; ACATTGCCATCATCAAGATCAACGG
>probe:Drosophila_2:1638377_x_at:264:37; Interrogation_Position=367; Antisense; ATCATCAAGATCAACGGCGCCCTGA
>probe:Drosophila_2:1638377_x_at:184:547; Interrogation_Position=466; Antisense; GGATGGGGCACTCTCTCCTACGGAT
>probe:Drosophila_2:1638377_x_at:456:631; Interrogation_Position=746; Antisense; TCCGCTCCTGGGTGATCAACAACGC
>probe:Drosophila_2:1638377_x_at:727:295; Interrogation_Position=748; Antisense; CGCTCCTGGGTGATCAACAACGCCT
>probe:Drosophila_2:1638377_x_at:444:337; Interrogation_Position=749; Antisense; GCTCCTGGGTGATCAACAACGCCTA
>probe:Drosophila_2:1638377_x_at:591:279; Interrogation_Position=750; Antisense; CTCCTGGGTGATCAACAACGCCTAA

Paste this into a BLAST search page for me
GGATCCATCTACTCCAGCAACGTCAATCTACTCCAGCAACGTCATCGTGAAGCTACTGGAGCTCCGGCGGTGTCAGGCGGTGTCACCTTCTCTGTGTCCTCTTCTCTGTGTCCTCCTTCAAGAACTGTGTCCTCCTTCAAGAACCACGAGGGTCAACGACATTGCCATCATCAAGACATTGCCATCATCAAGATCAACGGATCATCAAGATCAACGGCGCCCTGAGGATGGGGCACTCTCTCCTACGGATTCCGCTCCTGGGTGATCAACAACGCCGCTCCTGGGTGATCAACAACGCCTGCTCCTGGGTGATCAACAACGCCTACTCCTGGGTGATCAACAACGCCTAA

Full Affymetrix probeset data:

Annotations for 1638377_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime