FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638378_at:

>probe:Drosophila_2:1638378_at:123:377; Interrogation_Position=424; Antisense; GAAGAACAAGCCAACGACTCCGAAG
>probe:Drosophila_2:1638378_at:112:455; Interrogation_Position=451; Antisense; GATAAGGACCATCAGCAATCCGCTG
>probe:Drosophila_2:1638378_at:729:645; Interrogation_Position=477; Antisense; TCATCGAAAGCGATCTGGCGCGCAT
>probe:Drosophila_2:1638378_at:155:583; Interrogation_Position=492; Antisense; TGGCGCGCATTCACATCAAGCACGA
>probe:Drosophila_2:1638378_at:517:251; Interrogation_Position=508; Antisense; CAAGCACGAAACACGGCCTTTGGAA
>probe:Drosophila_2:1638378_at:245:617; Interrogation_Position=552; Antisense; TGCAGCAGGCAATGGTCCACCCTAG
>probe:Drosophila_2:1638378_at:444:431; Interrogation_Position=580; Antisense; GAGTCCCAGCTTGAGGAGCGCACCA
>probe:Drosophila_2:1638378_at:46:389; Interrogation_Position=622; Antisense; GAAAAGTGCCACTCTACCGAATCAG
>probe:Drosophila_2:1638378_at:55:359; Interrogation_Position=651; Antisense; GCAAAGGTGTGATTATGTCTCCCAA
>probe:Drosophila_2:1638378_at:542:679; Interrogation_Position=664; Antisense; TATGTCTCCCAAAGTTCTAATGCCC
>probe:Drosophila_2:1638378_at:545:643; Interrogation_Position=679; Antisense; TCTAATGCCCAGAACTCAACAGGTG
>probe:Drosophila_2:1638378_at:361:463; Interrogation_Position=741; Antisense; GATTGCGATTACCAGTCTTAGTTTC
>probe:Drosophila_2:1638378_at:4:557; Interrogation_Position=792; Antisense; GGACTACGTCCGCATTCAAGTATTA
>probe:Drosophila_2:1638378_at:523:683; Interrogation_Position=865; Antisense; TATCACATTCCAGTGTACTCGTTCG

Paste this into a BLAST search page for me
GAAGAACAAGCCAACGACTCCGAAGGATAAGGACCATCAGCAATCCGCTGTCATCGAAAGCGATCTGGCGCGCATTGGCGCGCATTCACATCAAGCACGACAAGCACGAAACACGGCCTTTGGAATGCAGCAGGCAATGGTCCACCCTAGGAGTCCCAGCTTGAGGAGCGCACCAGAAAAGTGCCACTCTACCGAATCAGGCAAAGGTGTGATTATGTCTCCCAATATGTCTCCCAAAGTTCTAATGCCCTCTAATGCCCAGAACTCAACAGGTGGATTGCGATTACCAGTCTTAGTTTCGGACTACGTCCGCATTCAAGTATTATATCACATTCCAGTGTACTCGTTCG

Full Affymetrix probeset data:

Annotations for 1638378_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720