FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638382_at:

>probe:Drosophila_2:1638382_at:501:375; Interrogation_Position=1016; Antisense; GAAGAAGCCGTATCCGTATCCAATC
>probe:Drosophila_2:1638382_at:302:345; Interrogation_Position=1042; Antisense; GCAACATGAACGCACCCTAAGGGAT
>probe:Drosophila_2:1638382_at:420:299; Interrogation_Position=527; Antisense; CGCCGTGAATGTGCCAAGTTGAATA
>probe:Drosophila_2:1638382_at:278:25; Interrogation_Position=549; Antisense; ATAGGAGCGAGGAGAGCCCCTTCAT
>probe:Drosophila_2:1638382_at:346:205; Interrogation_Position=593; Antisense; AAGCCCATTCAGTTCTTTATCGACC
>probe:Drosophila_2:1638382_at:574:83; Interrogation_Position=647; Antisense; AGTGGACACCTTCAGCTGGATTGCG
>probe:Drosophila_2:1638382_at:711:449; Interrogation_Position=686; Antisense; GATCCCTTGGATCTGTACCGAATGG
>probe:Drosophila_2:1638382_at:330:3; Interrogation_Position=727; Antisense; ATTGGAGCCCAACGAGGACTTTGCC
>probe:Drosophila_2:1638382_at:394:557; Interrogation_Position=742; Antisense; GGACTTTGCCGAATACTTTCTGCAC
>probe:Drosophila_2:1638382_at:66:209; Interrogation_Position=772; Antisense; AAGCTTCTGCAAATGCATGCGGCCG
>probe:Drosophila_2:1638382_at:105:297; Interrogation_Position=810; Antisense; CGCCGTACGAACACCATCAGAAGAT
>probe:Drosophila_2:1638382_at:263:545; Interrogation_Position=838; Antisense; GGATCAGTCCGACGCATATCTCAGT
>probe:Drosophila_2:1638382_at:212:185; Interrogation_Position=956; Antisense; AAAATGTCCATTGGCAGCGCGAGGA
>probe:Drosophila_2:1638382_at:691:45; Interrogation_Position=989; Antisense; AGTCTAAGTCGGGAGGCTTCTGTCG

Paste this into a BLAST search page for me
GAAGAAGCCGTATCCGTATCCAATCGCAACATGAACGCACCCTAAGGGATCGCCGTGAATGTGCCAAGTTGAATAATAGGAGCGAGGAGAGCCCCTTCATAAGCCCATTCAGTTCTTTATCGACCAGTGGACACCTTCAGCTGGATTGCGGATCCCTTGGATCTGTACCGAATGGATTGGAGCCCAACGAGGACTTTGCCGGACTTTGCCGAATACTTTCTGCACAAGCTTCTGCAAATGCATGCGGCCGCGCCGTACGAACACCATCAGAAGATGGATCAGTCCGACGCATATCTCAGTAAAATGTCCATTGGCAGCGCGAGGAAGTCTAAGTCGGGAGGCTTCTGTCG

Full Affymetrix probeset data:

Annotations for 1638382_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720