FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638383_at:

>probe:Drosophila_2:1638383_at:270:185; Interrogation_Position=175; Antisense; AACAATTGTCGTTCAATGCTGAGCA
>probe:Drosophila_2:1638383_at:717:463; Interrogation_Position=212; Antisense; GATTGCAGCCCAGCAAAGAAGGCGA
>probe:Drosophila_2:1638383_at:231:257; Interrogation_Position=241; Antisense; CAAATTGCGAATTGCGGTACCAAGA
>probe:Drosophila_2:1638383_at:261:137; Interrogation_Position=297; Antisense; ACGAAATACGGATCAAGCGACACCA
>probe:Drosophila_2:1638383_at:21:137; Interrogation_Position=341; Antisense; ACGCACACAGTCACTCACGGTCGTG
>probe:Drosophila_2:1638383_at:445:651; Interrogation_Position=355; Antisense; TCACGGTCGTGCACGCAGAGGCGAA
>probe:Drosophila_2:1638383_at:538:439; Interrogation_Position=372; Antisense; GAGGCGAATGCCGTGTGTGCTTTAA
>probe:Drosophila_2:1638383_at:286:227; Interrogation_Position=408; Antisense; AAGGCGTTCCGAATGCTAATTGCAT
>probe:Drosophila_2:1638383_at:450:377; Interrogation_Position=451; Antisense; GAAGCTGTCTAAAGGATTGCTATGA
>probe:Drosophila_2:1638383_at:608:75; Interrogation_Position=524; Antisense; AGGAGGCGCCAAAGGCCCCAGAATA
>probe:Drosophila_2:1638383_at:573:239; Interrogation_Position=563; Antisense; AATAAGGCTGCATTATCTTCTCCAC
>probe:Drosophila_2:1638383_at:352:335; Interrogation_Position=569; Antisense; GCTGCATTATCTTCTCCACGAGAAG
>probe:Drosophila_2:1638383_at:16:101; Interrogation_Position=640; Antisense; AGAGGAAGCAGACGCATAAGCAGCA
>probe:Drosophila_2:1638383_at:523:263; Interrogation_Position=736; Antisense; CAGCAGCAGCGTATTTGGCGAAAAA

Paste this into a BLAST search page for me
AACAATTGTCGTTCAATGCTGAGCAGATTGCAGCCCAGCAAAGAAGGCGACAAATTGCGAATTGCGGTACCAAGAACGAAATACGGATCAAGCGACACCAACGCACACAGTCACTCACGGTCGTGTCACGGTCGTGCACGCAGAGGCGAAGAGGCGAATGCCGTGTGTGCTTTAAAAGGCGTTCCGAATGCTAATTGCATGAAGCTGTCTAAAGGATTGCTATGAAGGAGGCGCCAAAGGCCCCAGAATAAATAAGGCTGCATTATCTTCTCCACGCTGCATTATCTTCTCCACGAGAAGAGAGGAAGCAGACGCATAAGCAGCACAGCAGCAGCGTATTTGGCGAAAAA

Full Affymetrix probeset data:

Annotations for 1638383_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720