FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638385_at:

>probe:Drosophila_2:1638385_at:704:65; Interrogation_Position=13; Antisense; ATGGAGGTTCTTTGGCTGCTTCTTT
>probe:Drosophila_2:1638385_at:384:707; Interrogation_Position=134; Antisense; TTACGAGTTTCAAGAGCACCTGCGA
>probe:Drosophila_2:1638385_at:568:605; Interrogation_Position=167; Antisense; TGATCAATTGCAAACTACCGGACGT
>probe:Drosophila_2:1638385_at:671:247; Interrogation_Position=181; Antisense; CTACCGGACGTCTACAAATTCAAAG
>probe:Drosophila_2:1638385_at:425:155; Interrogation_Position=208; Antisense; ACACCTTATTATGGACACTGCTTTA
>probe:Drosophila_2:1638385_at:108:259; Interrogation_Position=223; Antisense; CACTGCTTTAGATCCACCATACAAA
>probe:Drosophila_2:1638385_at:361:171; Interrogation_Position=246; Antisense; AAAGTGCAAGGCCTATGTCCTGTTG
>probe:Drosophila_2:1638385_at:527:307; Interrogation_Position=257; Antisense; CCTATGTCCTGTTGCAGCAGCTGAA
>probe:Drosophila_2:1638385_at:248:397; Interrogation_Position=289; Antisense; GACAACTCCGTTGAAATGTTCGCTT
>probe:Drosophila_2:1638385_at:660:341; Interrogation_Position=30; Antisense; GCTTCTTTTGGTATCGCATCTGAGT
>probe:Drosophila_2:1638385_at:651:345; Interrogation_Position=45; Antisense; GCATCTGAGTTCAACGCAGGGCGAG
>probe:Drosophila_2:1638385_at:634:433; Interrogation_Position=67; Antisense; GAGGGAAACTGTACCACCTGTGCTG
>probe:Drosophila_2:1638385_at:285:261; Interrogation_Position=81; Antisense; CACCTGTGCTGCTTGGGTCGAGCGT
>probe:Drosophila_2:1638385_at:421:637; Interrogation_Position=98; Antisense; TCGAGCGTGCGGTATGTGGCTATAA

Paste this into a BLAST search page for me
ATGGAGGTTCTTTGGCTGCTTCTTTTTACGAGTTTCAAGAGCACCTGCGATGATCAATTGCAAACTACCGGACGTCTACCGGACGTCTACAAATTCAAAGACACCTTATTATGGACACTGCTTTACACTGCTTTAGATCCACCATACAAAAAAGTGCAAGGCCTATGTCCTGTTGCCTATGTCCTGTTGCAGCAGCTGAAGACAACTCCGTTGAAATGTTCGCTTGCTTCTTTTGGTATCGCATCTGAGTGCATCTGAGTTCAACGCAGGGCGAGGAGGGAAACTGTACCACCTGTGCTGCACCTGTGCTGCTTGGGTCGAGCGTTCGAGCGTGCGGTATGTGGCTATAA

Full Affymetrix probeset data:

Annotations for 1638385_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720