Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638386_at:

>probe:Drosophila_2:1638386_at:166:1; Interrogation_Position=1018; Antisense; TCCCACTTGGGCATCCGTTAAACGG
>probe:Drosophila_2:1638386_at:141:581; Interrogation_Position=1072; Antisense; TGGCCATGGCCGAGACTCAGCGAAT
>probe:Drosophila_2:1638386_at:82:405; Interrogation_Position=1085; Antisense; GACTCAGCGAATCAGTGGCACCGTA
>probe:Drosophila_2:1638386_at:31:239; Interrogation_Position=1120; Antisense; AATCGGCCAGCGGACGGAGTAGCAA
>probe:Drosophila_2:1638386_at:596:109; Interrogation_Position=1140; Antisense; AGCAAGCGACGCCTCAAGCCGGAAG
>probe:Drosophila_2:1638386_at:298:415; Interrogation_Position=1168; Antisense; GAGCCACCGATCTCAGTCTGGGCAA
>probe:Drosophila_2:1638386_at:144:83; Interrogation_Position=1242; Antisense; AGTGGATACCGGCTTTGCCAAAGCA
>probe:Drosophila_2:1638386_at:387:457; Interrogation_Position=1273; Antisense; GATAGTATACTATCCCCGATTTGCT
>probe:Drosophila_2:1638386_at:625:551; Interrogation_Position=848; Antisense; GGAGAATCCAGATGTTCCGCCTGTA
>probe:Drosophila_2:1638386_at:467:219; Interrogation_Position=882; Antisense; AAGTGTGAACGCACCGACGGGCAGA
>probe:Drosophila_2:1638386_at:134:269; Interrogation_Position=911; Antisense; CAGGAATGGCATTGGGCACGGACAT
>probe:Drosophila_2:1638386_at:281:391; Interrogation_Position=943; Antisense; GAAACGCTGGCAACGACCTGCTGAT
>probe:Drosophila_2:1638386_at:646:445; Interrogation_Position=968; Antisense; GATTGCCCCGGGAGCCGTTGTCAAA
>probe:Drosophila_2:1638386_at:360:183; Interrogation_Position=990; Antisense; AAAAGCGAGCTTCTCCTGGAGTCTA

Paste this into a BLAST search page for me
TCCCACTTGGGCATCCGTTAAACGGTGGCCATGGCCGAGACTCAGCGAATGACTCAGCGAATCAGTGGCACCGTAAATCGGCCAGCGGACGGAGTAGCAAAGCAAGCGACGCCTCAAGCCGGAAGGAGCCACCGATCTCAGTCTGGGCAAAGTGGATACCGGCTTTGCCAAAGCAGATAGTATACTATCCCCGATTTGCTGGAGAATCCAGATGTTCCGCCTGTAAAGTGTGAACGCACCGACGGGCAGACAGGAATGGCATTGGGCACGGACATGAAACGCTGGCAACGACCTGCTGATGATTGCCCCGGGAGCCGTTGTCAAAAAAAGCGAGCTTCTCCTGGAGTCTA

Full Affymetrix probeset data:

Annotations for 1638386_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime