FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638387_at:

>probe:Drosophila_2:1638387_at:95:77; Interrogation_Position=442; Antisense; AGGAGGTGCAGTACCAGCAGTTCAT
>probe:Drosophila_2:1638387_at:326:113; Interrogation_Position=457; Antisense; AGCAGTTCATAGCAGAGCCTCACGA
>probe:Drosophila_2:1638387_at:265:453; Interrogation_Position=497; Antisense; GATCATCAATGGTCACAGTGCCGCG
>probe:Drosophila_2:1638387_at:587:117; Interrogation_Position=526; Antisense; AGCTAAGGCTCGATGGTTCCAGTGA
>probe:Drosophila_2:1638387_at:674:671; Interrogation_Position=558; Antisense; TACGAAGTCGCGGATGTCACATCTG
>probe:Drosophila_2:1638387_at:683:151; Interrogation_Position=576; Antisense; ACATCTGATCAATCTGCCGCGAAAG
>probe:Drosophila_2:1638387_at:401:107; Interrogation_Position=599; Antisense; AGAACCGTCTGCCTTCTATGGAGAG
>probe:Drosophila_2:1638387_at:191:31; Interrogation_Position=657; Antisense; ATACACGAGGCATCGCTGCACTTTA
>probe:Drosophila_2:1638387_at:217:617; Interrogation_Position=673; Antisense; TGCACTTTAAGATAGCCCGCTTCAA
>probe:Drosophila_2:1638387_at:345:321; Interrogation_Position=687; Antisense; GCCCGCTTCAAGTACAATAATCCCG
>probe:Drosophila_2:1638387_at:30:489; Interrogation_Position=719; Antisense; GTACGTTCCGGAATTATAGCCCATG
>probe:Drosophila_2:1638387_at:65:83; Interrogation_Position=796; Antisense; AGGGACCTGCTGATTTCGCCTCGAA
>probe:Drosophila_2:1638387_at:703:315; Interrogation_Position=827; Antisense; GCCGCGGAACGCTCAATAAGTAGTA
>probe:Drosophila_2:1638387_at:608:465; Interrogation_Position=922; Antisense; GTTGTTATGCATATCGTTCGACGAA

Paste this into a BLAST search page for me
AGGAGGTGCAGTACCAGCAGTTCATAGCAGTTCATAGCAGAGCCTCACGAGATCATCAATGGTCACAGTGCCGCGAGCTAAGGCTCGATGGTTCCAGTGATACGAAGTCGCGGATGTCACATCTGACATCTGATCAATCTGCCGCGAAAGAGAACCGTCTGCCTTCTATGGAGAGATACACGAGGCATCGCTGCACTTTATGCACTTTAAGATAGCCCGCTTCAAGCCCGCTTCAAGTACAATAATCCCGGTACGTTCCGGAATTATAGCCCATGAGGGACCTGCTGATTTCGCCTCGAAGCCGCGGAACGCTCAATAAGTAGTAGTTGTTATGCATATCGTTCGACGAA

Full Affymetrix probeset data:

Annotations for 1638387_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720