FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638388_at:

>probe:Drosophila_2:1638388_at:532:541; Interrogation_Position=1028; Antisense; GGTTCCTCCATACTCAGCTATTGAA
>probe:Drosophila_2:1638388_at:449:95; Interrogation_Position=1062; Antisense; AGTTGTGCTGCTCGATCGGACTGAA
>probe:Drosophila_2:1638388_at:502:165; Interrogation_Position=1092; Antisense; AAATCTGACCGATTTCGTCACCGAG
>probe:Drosophila_2:1638388_at:160:341; Interrogation_Position=1144; Antisense; GCTATGTACTCCAATGCCCGATATA
>probe:Drosophila_2:1638388_at:399:211; Interrogation_Position=1168; Antisense; AAGAAGCACGTTAGCGCCATTCTCA
>probe:Drosophila_2:1638388_at:553:251; Interrogation_Position=633; Antisense; CAAGTATTTCCTCAAGTGCCTGCCA
>probe:Drosophila_2:1638388_at:329:267; Interrogation_Position=681; Antisense; CAGTGCGGCGGTTCACAAGATGCAA
>probe:Drosophila_2:1638388_at:145:185; Interrogation_Position=709; Antisense; AAAATCGTCGACCTTATGTATGCTA
>probe:Drosophila_2:1638388_at:292:61; Interrogation_Position=724; Antisense; ATGTATGCTATGAACACGCCCGATC
>probe:Drosophila_2:1638388_at:159:47; Interrogation_Position=746; Antisense; ATCCGCAGGACTTCAATGCTCTGAA
>probe:Drosophila_2:1638388_at:98:683; Interrogation_Position=883; Antisense; TATGATCTGATCTATTTCCTCCTGG
>probe:Drosophila_2:1638388_at:531:431; Interrogation_Position=933; Antisense; GAGTCAGTTCGATTACTTCATCAAG
>probe:Drosophila_2:1638388_at:174:455; Interrogation_Position=967; Antisense; GATCACCTGGTCGAGCACTTGAGAA
>probe:Drosophila_2:1638388_at:481:721; Interrogation_Position=985; Antisense; TTGAGAATGCTGAACTACCCCGAAG

Paste this into a BLAST search page for me
GGTTCCTCCATACTCAGCTATTGAAAGTTGTGCTGCTCGATCGGACTGAAAAATCTGACCGATTTCGTCACCGAGGCTATGTACTCCAATGCCCGATATAAAGAAGCACGTTAGCGCCATTCTCACAAGTATTTCCTCAAGTGCCTGCCACAGTGCGGCGGTTCACAAGATGCAAAAAATCGTCGACCTTATGTATGCTAATGTATGCTATGAACACGCCCGATCATCCGCAGGACTTCAATGCTCTGAATATGATCTGATCTATTTCCTCCTGGGAGTCAGTTCGATTACTTCATCAAGGATCACCTGGTCGAGCACTTGAGAATTGAGAATGCTGAACTACCCCGAAG

Full Affymetrix probeset data:

Annotations for 1638388_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720