FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638390_at:

>probe:Drosophila_2:1638390_at:653:181; Interrogation_Position=104; Antisense; AAAACAAGCCGCACACACAGTAGCA
>probe:Drosophila_2:1638390_at:269:253; Interrogation_Position=108; Antisense; CAAGCCGCACACACAGTAGCACATG
>probe:Drosophila_2:1638390_at:462:357; Interrogation_Position=114; Antisense; GCACACACAGTAGCACATGCGGACA
>probe:Drosophila_2:1638390_at:98:257; Interrogation_Position=119; Antisense; CACAGTAGCACATGCGGACAAAGGG
>probe:Drosophila_2:1638390_at:711:323; Interrogation_Position=144; Antisense; GCGCACTGCAGTGGTCGTCCGATGC
>probe:Drosophila_2:1638390_at:607:355; Interrogation_Position=146; Antisense; GCACTGCAGTGGTCGTCCGATGCTT
>probe:Drosophila_2:1638390_at:605:617; Interrogation_Position=150; Antisense; TGCAGTGGTCGTCCGATGCTTCCTG
>probe:Drosophila_2:1638390_at:174:85; Interrogation_Position=153; Antisense; AGTGGTCGTCCGATGCTTCCTGCGC
>probe:Drosophila_2:1638390_at:89:633; Interrogation_Position=161; Antisense; TCCGATGCTTCCTGCGCCGCTAAGT
>probe:Drosophila_2:1638390_at:553:623; Interrogation_Position=173; Antisense; TGCGCCGCTAAGTATGCCACTGCAA
>probe:Drosophila_2:1638390_at:603:319; Interrogation_Position=176; Antisense; GCCGCTAAGTATGCCACTGCAATGC
>probe:Drosophila_2:1638390_at:352:337; Interrogation_Position=179; Antisense; GCTAAGTATGCCACTGCAATGCTAT
>probe:Drosophila_2:1638390_at:8:219; Interrogation_Position=182; Antisense; AAGTATGCCACTGCAATGCTATTTT
>probe:Drosophila_2:1638390_at:21:683; Interrogation_Position=185; Antisense; TATGCCACTGCAATGCTATTTTAAG

Paste this into a BLAST search page for me
AAAACAAGCCGCACACACAGTAGCACAAGCCGCACACACAGTAGCACATGGCACACACAGTAGCACATGCGGACACACAGTAGCACATGCGGACAAAGGGGCGCACTGCAGTGGTCGTCCGATGCGCACTGCAGTGGTCGTCCGATGCTTTGCAGTGGTCGTCCGATGCTTCCTGAGTGGTCGTCCGATGCTTCCTGCGCTCCGATGCTTCCTGCGCCGCTAAGTTGCGCCGCTAAGTATGCCACTGCAAGCCGCTAAGTATGCCACTGCAATGCGCTAAGTATGCCACTGCAATGCTATAAGTATGCCACTGCAATGCTATTTTTATGCCACTGCAATGCTATTTTAAG

Full Affymetrix probeset data:

Annotations for 1638390_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720