FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638394_at:

>probe:Drosophila_2:1638394_at:480:639; Interrogation_Position=2253; Antisense; TCGTGCTGCTGAGGAACTGGTCTTC
>probe:Drosophila_2:1638394_at:442:135; Interrogation_Position=2268; Antisense; ACTGGTCTTCGGCACGGACAAGATT
>probe:Drosophila_2:1638394_at:18:397; Interrogation_Position=2284; Antisense; GACAAGATTACGTCGGGAGCCAGCA
>probe:Drosophila_2:1638394_at:322:85; Interrogation_Position=2308; Antisense; AGTGATCTCAAGCAGGCAACCTCGA
>probe:Drosophila_2:1638394_at:152:45; Interrogation_Position=2332; Antisense; ATCGCGACGCATATGGTCAGGGACT
>probe:Drosophila_2:1638394_at:695:9; Interrogation_Position=2362; Antisense; ATGTCGGACAAGGTCGGTCTTCGCA
>probe:Drosophila_2:1638394_at:695:635; Interrogation_Position=2382; Antisense; TCGCACCATCGAGGCGTCAAAGGGT
>probe:Drosophila_2:1638394_at:697:187; Interrogation_Position=2434; Antisense; AACACCATTGAAGCCGTGGACGCGG
>probe:Drosophila_2:1638394_at:468:551; Interrogation_Position=2457; Antisense; GGAGATCAAGCGCATCCTCAGCGAC
>probe:Drosophila_2:1638394_at:666:329; Interrogation_Position=2490; Antisense; GCGGGCGAAGGCTATCCTGCGAAAA
>probe:Drosophila_2:1638394_at:491:617; Interrogation_Position=2538; Antisense; TGCGGAGGCGCTTCTCAAGTACGAG
>probe:Drosophila_2:1638394_at:97:91; Interrogation_Position=2555; Antisense; AGTACGAGACTCTTGACGCCGACGA
>probe:Drosophila_2:1638394_at:187:365; Interrogation_Position=2595; Antisense; GAATGAAAGCCAGACGTAGTTCCCC
>probe:Drosophila_2:1638394_at:435:627; Interrogation_Position=2673; Antisense; TGCCACCGGACATTCAGCTGAACTG

Paste this into a BLAST search page for me
TCGTGCTGCTGAGGAACTGGTCTTCACTGGTCTTCGGCACGGACAAGATTGACAAGATTACGTCGGGAGCCAGCAAGTGATCTCAAGCAGGCAACCTCGAATCGCGACGCATATGGTCAGGGACTATGTCGGACAAGGTCGGTCTTCGCATCGCACCATCGAGGCGTCAAAGGGTAACACCATTGAAGCCGTGGACGCGGGGAGATCAAGCGCATCCTCAGCGACGCGGGCGAAGGCTATCCTGCGAAAATGCGGAGGCGCTTCTCAAGTACGAGAGTACGAGACTCTTGACGCCGACGAGAATGAAAGCCAGACGTAGTTCCCCTGCCACCGGACATTCAGCTGAACTG

Full Affymetrix probeset data:

Annotations for 1638394_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720