FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638395_at:

>probe:Drosophila_2:1638395_at:15:205; Interrogation_Position=247; Antisense; AAGCCTTCGATTTGTTCGACACCCA
>probe:Drosophila_2:1638395_at:640:85; Interrogation_Position=271; Antisense; AGTGCACGGGCTTTATCGAAACCAA
>probe:Drosophila_2:1638395_at:186:175; Interrogation_Position=289; Antisense; AAACCAAGGAGCTTCGCGTGGCCAT
>probe:Drosophila_2:1638395_at:632:291; Interrogation_Position=315; Antisense; CGTGCCCTGGGATTCGAGCCGAAGA
>probe:Drosophila_2:1638395_at:336:79; Interrogation_Position=390; Antisense; AGGATTGCCTTTAACGATTTTCTAT
>probe:Drosophila_2:1638395_at:233:461; Interrogation_Position=405; Antisense; GATTTTCTATATCTGATGCGCCTGA
>probe:Drosophila_2:1638395_at:130:69; Interrogation_Position=466; Antisense; AGGCCTTTTCCTTCTTCGATGACGA
>probe:Drosophila_2:1638395_at:240:445; Interrogation_Position=483; Antisense; GATGACGATCGCACCGGCGGCATAT
>probe:Drosophila_2:1638395_at:173:717; Interrogation_Position=510; Antisense; TTCCTCAACTTGAAACGCGTGGCCA
>probe:Drosophila_2:1638395_at:361:405; Interrogation_Position=582; Antisense; GACGAAGCCAACGTTTCCGGTGATG
>probe:Drosophila_2:1638395_at:121:127; Interrogation_Position=648; Antisense; ACCAATCTCATCTAGTTGCATTACG
>probe:Drosophila_2:1638395_at:280:461; Interrogation_Position=735; Antisense; GATTTACTCATTTTTCAGACAGACA
>probe:Drosophila_2:1638395_at:153:33; Interrogation_Position=761; Antisense; ATCAATCTGACTCGAAACCCATTAC
>probe:Drosophila_2:1638395_at:660:217; Interrogation_Position=793; Antisense; AAGTTTGGATATGCTTCGGTTCAAT

Paste this into a BLAST search page for me
AAGCCTTCGATTTGTTCGACACCCAAGTGCACGGGCTTTATCGAAACCAAAAACCAAGGAGCTTCGCGTGGCCATCGTGCCCTGGGATTCGAGCCGAAGAAGGATTGCCTTTAACGATTTTCTATGATTTTCTATATCTGATGCGCCTGAAGGCCTTTTCCTTCTTCGATGACGAGATGACGATCGCACCGGCGGCATATTTCCTCAACTTGAAACGCGTGGCCAGACGAAGCCAACGTTTCCGGTGATGACCAATCTCATCTAGTTGCATTACGGATTTACTCATTTTTCAGACAGACAATCAATCTGACTCGAAACCCATTACAAGTTTGGATATGCTTCGGTTCAAT

Full Affymetrix probeset data:

Annotations for 1638395_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720