Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638397_at:

>probe:Drosophila_2:1638397_at:448:265; Interrogation_Position=1029; Antisense; CAGAGCCATTCTGCTAGATTGTGAT
>probe:Drosophila_2:1638397_at:634:513; Interrogation_Position=1049; Antisense; GTGATATAGTCTTCCGATCCGATGT
>probe:Drosophila_2:1638397_at:628:293; Interrogation_Position=1068; Antisense; CGATGTCCGACTGCTGTTCAATGAG
>probe:Drosophila_2:1638397_at:259:497; Interrogation_Position=1118; Antisense; TGTACGGACTGGCACCGGAACTGAC
>probe:Drosophila_2:1638397_at:388:507; Interrogation_Position=1177; Antisense; GTGCGCTATCCGAAGACCAGTTTCG
>probe:Drosophila_2:1638397_at:466:563; Interrogation_Position=1202; Antisense; GGAATCCCTACTATCCGATCAACAA
>probe:Drosophila_2:1638397_at:229:31; Interrogation_Position=1309; Antisense; ATCCGTAACTCAAAGTCCTACCTGG
>probe:Drosophila_2:1638397_at:241:109; Interrogation_Position=1334; Antisense; AGAAGCTGACCCACTCGGAGGTGCA
>probe:Drosophila_2:1638397_at:410:133; Interrogation_Position=1414; Antisense; ACCCTGCTGGGATACGAGTACCCGA
>probe:Drosophila_2:1638397_at:296:427; Interrogation_Position=1429; Antisense; GAGTACCCGAACTTAATCTACAGAC
>probe:Drosophila_2:1638397_at:275:407; Interrogation_Position=1451; Antisense; GACTGGACTGCATTTGGAACCGCCA
>probe:Drosophila_2:1638397_at:716:543; Interrogation_Position=1501; Antisense; GGATACTCACAGATATTCGACGCTT
>probe:Drosophila_2:1638397_at:608:297; Interrogation_Position=1521; Antisense; CGCTTATTTCCGGTGCGAGGGCAAT
>probe:Drosophila_2:1638397_at:713:487; Interrogation_Position=1554; Antisense; GTACCATGGCAACTGTAATACGCGA

Paste this into a BLAST search page for me
CAGAGCCATTCTGCTAGATTGTGATGTGATATAGTCTTCCGATCCGATGTCGATGTCCGACTGCTGTTCAATGAGTGTACGGACTGGCACCGGAACTGACGTGCGCTATCCGAAGACCAGTTTCGGGAATCCCTACTATCCGATCAACAAATCCGTAACTCAAAGTCCTACCTGGAGAAGCTGACCCACTCGGAGGTGCAACCCTGCTGGGATACGAGTACCCGAGAGTACCCGAACTTAATCTACAGACGACTGGACTGCATTTGGAACCGCCAGGATACTCACAGATATTCGACGCTTCGCTTATTTCCGGTGCGAGGGCAATGTACCATGGCAACTGTAATACGCGA

Full Affymetrix probeset data:

Annotations for 1638397_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime