FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638399_at:

>probe:Drosophila_2:1638399_at:446:507; Interrogation_Position=1014; Antisense; GTGCTACCAACTGCTAAATGTCTTC
>probe:Drosophila_2:1638399_at:439:727; Interrogation_Position=1050; Antisense; TTGGCCCATCAACTACATATACTTC
>probe:Drosophila_2:1638399_at:16:669; Interrogation_Position=1085; Antisense; TACTCTACCTCATTGGACGAACGGC
>probe:Drosophila_2:1638399_at:704:553; Interrogation_Position=1099; Antisense; GGACGAACGGCCTTTGTATTCCTCA
>probe:Drosophila_2:1638399_at:171:155; Interrogation_Position=1237; Antisense; ACAGTGGCACTTTCCGGCAAGAAGT
>probe:Drosophila_2:1638399_at:324:563; Interrogation_Position=1252; Antisense; GGCAAGAAGTTCTATTTCCTCACCC
>probe:Drosophila_2:1638399_at:52:297; Interrogation_Position=1279; Antisense; CGACTGCTCTTTGGAATGGCTGGAA
>probe:Drosophila_2:1638399_at:490:67; Interrogation_Position=1294; Antisense; ATGGCTGGAACCATTGTCACCTACG
>probe:Drosophila_2:1638399_at:441:195; Interrogation_Position=1319; Antisense; AACTGGTCCTTTTGCAATTCGATGA
>probe:Drosophila_2:1638399_at:726:343; Interrogation_Position=830; Antisense; GCTTGTCCTACCGATTCGAGCAAAT
>probe:Drosophila_2:1638399_at:271:367; Interrogation_Position=895; Antisense; GAATCGGTGTTCATCCAAATCAGGG
>probe:Drosophila_2:1638399_at:339:429; Interrogation_Position=949; Antisense; GAGTTCGTGGATAGCGCCATGTCCA
>probe:Drosophila_2:1638399_at:157:499; Interrogation_Position=974; Antisense; GTCTCATTCTACTTTCGTGTGTTAA
>probe:Drosophila_2:1638399_at:205:253; Interrogation_Position=999; Antisense; CAACCTGTACTTTGTGTGCTACCAA

Paste this into a BLAST search page for me
GTGCTACCAACTGCTAAATGTCTTCTTGGCCCATCAACTACATATACTTCTACTCTACCTCATTGGACGAACGGCGGACGAACGGCCTTTGTATTCCTCAACAGTGGCACTTTCCGGCAAGAAGTGGCAAGAAGTTCTATTTCCTCACCCCGACTGCTCTTTGGAATGGCTGGAAATGGCTGGAACCATTGTCACCTACGAACTGGTCCTTTTGCAATTCGATGAGCTTGTCCTACCGATTCGAGCAAATGAATCGGTGTTCATCCAAATCAGGGGAGTTCGTGGATAGCGCCATGTCCAGTCTCATTCTACTTTCGTGTGTTAACAACCTGTACTTTGTGTGCTACCAA

Full Affymetrix probeset data:

Annotations for 1638399_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720