FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638400_at:

>probe:Drosophila_2:1638400_at:93:327; Interrogation_Position=1282; Antisense; GCGAGTGCCACAAGCAGGTCCAGAA
>probe:Drosophila_2:1638400_at:174:381; Interrogation_Position=1317; Antisense; GAACGCATTTTGGAACGGGCTGGCA
>probe:Drosophila_2:1638400_at:229:321; Interrogation_Position=1412; Antisense; GCCGCCACAGCATTTTCACATGAGT
>probe:Drosophila_2:1638400_at:63:13; Interrogation_Position=1440; Antisense; ATTAAAATCCTGCTCGTTCAGCTGC
>probe:Drosophila_2:1638400_at:424:513; Interrogation_Position=1491; Antisense; GTGATCCCGGATGACAGACTGCTGC
>probe:Drosophila_2:1638400_at:197:177; Interrogation_Position=1557; Antisense; AAACTGACGCCGTGCGAAGTTCGCA
>probe:Drosophila_2:1638400_at:664:693; Interrogation_Position=1594; Antisense; TTTGCTTCGAACTGCACTCGGCAAT
>probe:Drosophila_2:1638400_at:238:245; Interrogation_Position=1616; Antisense; AATTGCCGAACAGACTCGTCGTGTA
>probe:Drosophila_2:1638400_at:464:599; Interrogation_Position=1637; Antisense; TGTAGCCCTTGAAACGAGCCTGTCG
>probe:Drosophila_2:1638400_at:437:17; Interrogation_Position=1669; Antisense; ATCGACTGGAGGAGTCCCTGTTTTA
>probe:Drosophila_2:1638400_at:421:585; Interrogation_Position=1696; Antisense; TGGACAAGTGCGTCAACTATCTGAA
>probe:Drosophila_2:1638400_at:728:709; Interrogation_Position=1737; Antisense; TTCATCGAGGGTCACGTGCTTAAGC
>probe:Drosophila_2:1638400_at:663:537; Interrogation_Position=1793; Antisense; GGTCATGTCCTAGGCAACCAGATAA
>probe:Drosophila_2:1638400_at:643:207; Interrogation_Position=1836; Antisense; AAGCTTGCCTGTATTGAAATTGCCA

Paste this into a BLAST search page for me
GCGAGTGCCACAAGCAGGTCCAGAAGAACGCATTTTGGAACGGGCTGGCAGCCGCCACAGCATTTTCACATGAGTATTAAAATCCTGCTCGTTCAGCTGCGTGATCCCGGATGACAGACTGCTGCAAACTGACGCCGTGCGAAGTTCGCATTTGCTTCGAACTGCACTCGGCAATAATTGCCGAACAGACTCGTCGTGTATGTAGCCCTTGAAACGAGCCTGTCGATCGACTGGAGGAGTCCCTGTTTTATGGACAAGTGCGTCAACTATCTGAATTCATCGAGGGTCACGTGCTTAAGCGGTCATGTCCTAGGCAACCAGATAAAAGCTTGCCTGTATTGAAATTGCCA

Full Affymetrix probeset data:

Annotations for 1638400_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720