FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638401_at:

>probe:Drosophila_2:1638401_at:285:235; Interrogation_Position=112; Antisense; AATGCCACATTCATAGAACCAGCGA
>probe:Drosophila_2:1638401_at:154:109; Interrogation_Position=126; Antisense; AGAACCAGCGAAAAACATATACCTT
>probe:Drosophila_2:1638401_at:481:389; Interrogation_Position=135; Antisense; GAAAAACATATACCTTCACATGAAG
>probe:Drosophila_2:1638401_at:420:369; Interrogation_Position=18; Antisense; GAATGCTGTGTGCAAGTCGTACAAC
>probe:Drosophila_2:1638401_at:396:227; Interrogation_Position=231; Antisense; AAGGCGCAACCAGCCGTTCGCTAAA
>probe:Drosophila_2:1638401_at:510:251; Interrogation_Position=237; Antisense; CAACCAGCCGTTCGCTAAAATCGTT
>probe:Drosophila_2:1638401_at:662:595; Interrogation_Position=24; Antisense; TGTGTGCAAGTCGTACAACAAATCG
>probe:Drosophila_2:1638401_at:162:263; Interrogation_Position=241; Antisense; CAGCCGTTCGCTAAAATCGTTTGGA
>probe:Drosophila_2:1638401_at:179:237; Interrogation_Position=255; Antisense; AATCGTTTGGAACATGATCAAGAAC
>probe:Drosophila_2:1638401_at:389:453; Interrogation_Position=270; Antisense; GATCAAGAACGTATCCACGGTCAAC
>probe:Drosophila_2:1638401_at:571:207; Interrogation_Position=274; Antisense; AAGAACGTATCCACGGTCAACCACA
>probe:Drosophila_2:1638401_at:312:679; Interrogation_Position=82; Antisense; TATTCCCGAACCAAGACCAGCCTGA
>probe:Drosophila_2:1638401_at:73:381; Interrogation_Position=89; Antisense; GAACCAAGACCAGCCTGAACATAAA
>probe:Drosophila_2:1638401_at:53:263; Interrogation_Position=99; Antisense; CAGCCTGAACATAAATGCCACATTC

Paste this into a BLAST search page for me
AATGCCACATTCATAGAACCAGCGAAGAACCAGCGAAAAACATATACCTTGAAAAACATATACCTTCACATGAAGGAATGCTGTGTGCAAGTCGTACAACAAGGCGCAACCAGCCGTTCGCTAAACAACCAGCCGTTCGCTAAAATCGTTTGTGTGCAAGTCGTACAACAAATCGCAGCCGTTCGCTAAAATCGTTTGGAAATCGTTTGGAACATGATCAAGAACGATCAAGAACGTATCCACGGTCAACAAGAACGTATCCACGGTCAACCACATATTCCCGAACCAAGACCAGCCTGAGAACCAAGACCAGCCTGAACATAAACAGCCTGAACATAAATGCCACATTC

Full Affymetrix probeset data:

Annotations for 1638401_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720