FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638403_at:

>probe:Drosophila_2:1638403_at:544:633; Interrogation_Position=108; Antisense; TCGCGATGACTGTCTGTACGAGAAT
>probe:Drosophila_2:1638403_at:404:109; Interrogation_Position=144; Antisense; AGAAGCAGTGCGTCGTCTGCCCCGC
>probe:Drosophila_2:1638403_at:590:641; Interrogation_Position=159; Antisense; TCTGCCCCGCAAACTGTACGATGAA
>probe:Drosophila_2:1638403_at:264:177; Interrogation_Position=169; Antisense; AAACTGTACGATGAACGCAACTATC
>probe:Drosophila_2:1638403_at:242:359; Interrogation_Position=185; Antisense; GCAACTATCGCATTCTTCGAGCACT
>probe:Drosophila_2:1638403_at:22:243; Interrogation_Position=20; Antisense; AATATGTGGCTAGAGTGGGCCCAGC
>probe:Drosophila_2:1638403_at:280:715; Interrogation_Position=200; Antisense; TTCGAGCACTGCACCTTTCCATGAC
>probe:Drosophila_2:1638403_at:227:693; Interrogation_Position=215; Antisense; TTTCCATGACCAAGACGATCCTGCC
>probe:Drosophila_2:1638403_at:328:557; Interrogation_Position=267; Antisense; GGACATCAAGTACTTGGAGCCCTAT
>probe:Drosophila_2:1638403_at:330:553; Interrogation_Position=282; Antisense; GGAGCCCTATCTTAACGAAGTGCAA
>probe:Drosophila_2:1638403_at:348:577; Interrogation_Position=37; Antisense; GGCCCAGCGGTTTTCTCCAAGTTGG
>probe:Drosophila_2:1638403_at:52:627; Interrogation_Position=52; Antisense; TCCAAGTTGGGAAAGTGGGCCTACA
>probe:Drosophila_2:1638403_at:529:523; Interrogation_Position=68; Antisense; GGGCCTACAACATGTCTGGATTCAA
>probe:Drosophila_2:1638403_at:216:241; Interrogation_Position=95; Antisense; AATACGGCCTGTATCGCGATGACTG

Paste this into a BLAST search page for me
TCGCGATGACTGTCTGTACGAGAATAGAAGCAGTGCGTCGTCTGCCCCGCTCTGCCCCGCAAACTGTACGATGAAAAACTGTACGATGAACGCAACTATCGCAACTATCGCATTCTTCGAGCACTAATATGTGGCTAGAGTGGGCCCAGCTTCGAGCACTGCACCTTTCCATGACTTTCCATGACCAAGACGATCCTGCCGGACATCAAGTACTTGGAGCCCTATGGAGCCCTATCTTAACGAAGTGCAAGGCCCAGCGGTTTTCTCCAAGTTGGTCCAAGTTGGGAAAGTGGGCCTACAGGGCCTACAACATGTCTGGATTCAAAATACGGCCTGTATCGCGATGACTG

Full Affymetrix probeset data:

Annotations for 1638403_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720