FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638405_at:

>probe:Drosophila_2:1638405_at:91:87; Interrogation_Position=161; Antisense; AGTGCGATTCCTTGACTAATTCCGA
>probe:Drosophila_2:1638405_at:246:91; Interrogation_Position=211; Antisense; AGTAGCCTCGTTTTGGATTGCACCA
>probe:Drosophila_2:1638405_at:716:489; Interrogation_Position=320; Antisense; GTAACCCGCAAATCGTGAGGTCCTG
>probe:Drosophila_2:1638405_at:510:607; Interrogation_Position=335; Antisense; TGAGGTCCTGCTACTTTGGCAACAT
>probe:Drosophila_2:1638405_at:695:189; Interrogation_Position=355; Antisense; AACATCGCCGACACGAAGGTTGGAT
>probe:Drosophila_2:1638405_at:22:223; Interrogation_Position=370; Antisense; AAGGTTGGATGCCAGACCGATCCCA
>probe:Drosophila_2:1638405_at:520:45; Interrogation_Position=389; Antisense; ATCCCAGCCTGACGATCAACAAGTT
>probe:Drosophila_2:1638405_at:179:621; Interrogation_Position=413; Antisense; TGCTGAGCTGCGAGGTTTGCACCGA
>probe:Drosophila_2:1638405_at:599:431; Interrogation_Position=479; Antisense; GAGTCATACTCCTGTTCTTTGGCCT
>probe:Drosophila_2:1638405_at:385:265; Interrogation_Position=531; Antisense; CAGTTTGTAGTACCGCTGAGCTATC
>probe:Drosophila_2:1638405_at:157:335; Interrogation_Position=545; Antisense; GCTGAGCTATCCCAAACATATCGAA
>probe:Drosophila_2:1638405_at:464:587; Interrogation_Position=594; Antisense; TGGAGCTGCTTTAGTCACCTTTGAA
>probe:Drosophila_2:1638405_at:25:139; Interrogation_Position=646; Antisense; ACTGTTTTCGCCCACATTAAATGTC
>probe:Drosophila_2:1638405_at:267:181; Interrogation_Position=93; Antisense; AAAAATGATCTTGGCTCTCACCGTC

Paste this into a BLAST search page for me
AGTGCGATTCCTTGACTAATTCCGAAGTAGCCTCGTTTTGGATTGCACCAGTAACCCGCAAATCGTGAGGTCCTGTGAGGTCCTGCTACTTTGGCAACATAACATCGCCGACACGAAGGTTGGATAAGGTTGGATGCCAGACCGATCCCAATCCCAGCCTGACGATCAACAAGTTTGCTGAGCTGCGAGGTTTGCACCGAGAGTCATACTCCTGTTCTTTGGCCTCAGTTTGTAGTACCGCTGAGCTATCGCTGAGCTATCCCAAACATATCGAATGGAGCTGCTTTAGTCACCTTTGAAACTGTTTTCGCCCACATTAAATGTCAAAAATGATCTTGGCTCTCACCGTC

Full Affymetrix probeset data:

Annotations for 1638405_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720