FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638407_at:

>probe:Drosophila_2:1638407_at:318:9; Interrogation_Position=502; Antisense; ATTGCCGTACAGTCGAGTGCAGCGA
>probe:Drosophila_2:1638407_at:336:417; Interrogation_Position=547; Antisense; GAGCGAGAGGAATCATCACACCTAT
>probe:Drosophila_2:1638407_at:599:405; Interrogation_Position=625; Antisense; GACGGATAATCTCCCCGAACTGAAA
>probe:Drosophila_2:1638407_at:349:381; Interrogation_Position=641; Antisense; GAACTGAAACTTCGCTTGGCCTCCT
>probe:Drosophila_2:1638407_at:251:729; Interrogation_Position=656; Antisense; TTGGCCTCCTTACTGCGGCAAAACA
>probe:Drosophila_2:1638407_at:247:175; Interrogation_Position=680; Antisense; AAAGCGCGCTTCTTCAATCGACATT
>probe:Drosophila_2:1638407_at:179:9; Interrogation_Position=736; Antisense; ATTGCCGAGCGTAACACCATTAAGC
>probe:Drosophila_2:1638407_at:252:615; Interrogation_Position=803; Antisense; TGCAAAGCCACCGATAGTACCATTA
>probe:Drosophila_2:1638407_at:379:89; Interrogation_Position=818; Antisense; AGTACCATTACCGATTTGGCCAAAG
>probe:Drosophila_2:1638407_at:174:703; Interrogation_Position=849; Antisense; TTTTGTTCAAATGTCGGCCTCTGGA
>probe:Drosophila_2:1638407_at:585:79; Interrogation_Position=882; Antisense; AGGTCGCGTACAAACTCAGGCAGTG
>probe:Drosophila_2:1638407_at:607:295; Interrogation_Position=944; Antisense; CCAAACAAGCCGCTCGTCGAGTTAA
>probe:Drosophila_2:1638407_at:11:169; Interrogation_Position=967; Antisense; AAATGATCGTCAAATGGCCCGCTAT
>probe:Drosophila_2:1638407_at:702:575; Interrogation_Position=982; Antisense; GGCCCGCTATCAGGAGTTTCGTAAA

Paste this into a BLAST search page for me
ATTGCCGTACAGTCGAGTGCAGCGAGAGCGAGAGGAATCATCACACCTATGACGGATAATCTCCCCGAACTGAAAGAACTGAAACTTCGCTTGGCCTCCTTTGGCCTCCTTACTGCGGCAAAACAAAAGCGCGCTTCTTCAATCGACATTATTGCCGAGCGTAACACCATTAAGCTGCAAAGCCACCGATAGTACCATTAAGTACCATTACCGATTTGGCCAAAGTTTTGTTCAAATGTCGGCCTCTGGAAGGTCGCGTACAAACTCAGGCAGTGCCAAACAAGCCGCTCGTCGAGTTAAAAATGATCGTCAAATGGCCCGCTATGGCCCGCTATCAGGAGTTTCGTAAA

Full Affymetrix probeset data:

Annotations for 1638407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720