Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638409_at:

>probe:Drosophila_2:1638409_at:533:125; Interrogation_Position=1215; Antisense; AGCCTGAGTGTCTACGGCAGCGACT
>probe:Drosophila_2:1638409_at:619:623; Interrogation_Position=1264; Antisense; TGCGCGATTACATCCACATCGTGGA
>probe:Drosophila_2:1638409_at:387:559; Interrogation_Position=1285; Antisense; TGGACCTGGCCGAGGGACACGTAAA
>probe:Drosophila_2:1638409_at:168:189; Interrogation_Position=1329; Antisense; AACATCGCGGAGACGGGCTTTTTCG
>probe:Drosophila_2:1638409_at:82:571; Interrogation_Position=1344; Antisense; GGCTTTTTCGCCTACAATTTGGGCA
>probe:Drosophila_2:1638409_at:602:369; Interrogation_Position=1412; Antisense; GAAGGCCTCCGGCAAGAAGGTCAAC
>probe:Drosophila_2:1638409_at:560:371; Interrogation_Position=1427; Antisense; GAAGGTCAACTACACTCTGGTGGAC
>probe:Drosophila_2:1638409_at:311:99; Interrogation_Position=1463; Antisense; AGATGTGGCCACTTGCTATGCGGAC
>probe:Drosophila_2:1638409_at:667:227; Interrogation_Position=1518; Antisense; AAGGCCGAGCGTGGCATCGACAAGA
>probe:Drosophila_2:1638409_at:144:487; Interrogation_Position=1598; Antisense; GTAGAGCTGTATATCGCCACGTTCC
>probe:Drosophila_2:1638409_at:226:217; Interrogation_Position=1634; Antisense; AAGTTCCTGAGTTACTACGCCTGAT
>probe:Drosophila_2:1638409_at:553:307; Interrogation_Position=1709; Antisense; CCAAATTTCGTGTAGTATTCGCTCA
>probe:Drosophila_2:1638409_at:443:689; Interrogation_Position=1724; Antisense; TATTCGCTCACTTCGATGTGTGCAA
>probe:Drosophila_2:1638409_at:69:227; Interrogation_Position=1785; Antisense; AAGGCTTTTCGCTGTTGTCATGTAA

Paste this into a BLAST search page for me
AGCCTGAGTGTCTACGGCAGCGACTTGCGCGATTACATCCACATCGTGGATGGACCTGGCCGAGGGACACGTAAAAACATCGCGGAGACGGGCTTTTTCGGGCTTTTTCGCCTACAATTTGGGCAGAAGGCCTCCGGCAAGAAGGTCAACGAAGGTCAACTACACTCTGGTGGACAGATGTGGCCACTTGCTATGCGGACAAGGCCGAGCGTGGCATCGACAAGAGTAGAGCTGTATATCGCCACGTTCCAAGTTCCTGAGTTACTACGCCTGATCCAAATTTCGTGTAGTATTCGCTCATATTCGCTCACTTCGATGTGTGCAAAAGGCTTTTCGCTGTTGTCATGTAA

Full Affymetrix probeset data:

Annotations for 1638409_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime