FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638410_at:

>probe:Drosophila_2:1638410_at:573:721; Interrogation_Position=1008; Antisense; TTGAATGTCACACGGCCAGACGGTT
>probe:Drosophila_2:1638410_at:244:253; Interrogation_Position=492; Antisense; CAACCAGATCGTGGTCTGCCAGAAT
>probe:Drosophila_2:1638410_at:427:65; Interrogation_Position=535; Antisense; ATGGTCCATGGAGTGCTAACGCACG
>probe:Drosophila_2:1638410_at:198:463; Interrogation_Position=564; Antisense; GATTCACATGTTCGACTACTGCAAT
>probe:Drosophila_2:1638410_at:638:659; Interrogation_Position=588; Antisense; TAACGACATGGACTTCCGCAACGTG
>probe:Drosophila_2:1638410_at:32:727; Interrogation_Position=667; Antisense; TTGAGCGCCATGTTCCAAGGAGATG
>probe:Drosophila_2:1638410_at:473:427; Interrogation_Position=686; Antisense; GAGATGCCTCGCCATTTAATGTCAA
>probe:Drosophila_2:1638410_at:15:109; Interrogation_Position=722; Antisense; AGAACTGCGTCAAGTCCAAAGCCCT
>probe:Drosophila_2:1638410_at:601:289; Interrogation_Position=753; Antisense; CGTGCTCGCTGTTCGCAATATTAGC
>probe:Drosophila_2:1638410_at:48:619; Interrogation_Position=795; Antisense; TGCTGTGGAACGTGTCTTTCCCAAA
>probe:Drosophila_2:1638410_at:244:619; Interrogation_Position=820; Antisense; TGCTATGCAGACTTGGAGCCCATTG
>probe:Drosophila_2:1638410_at:158:3; Interrogation_Position=841; Antisense; ATTGGCCGGAGAATCCGTCGCAATT
>probe:Drosophila_2:1638410_at:695:245; Interrogation_Position=862; Antisense; AATTCCACGGACCAGCAGAAGGCTT
>probe:Drosophila_2:1638410_at:704:263; Interrogation_Position=877; Antisense; CAGAAGGCTTACATGGAGGCACCCA

Paste this into a BLAST search page for me
TTGAATGTCACACGGCCAGACGGTTCAACCAGATCGTGGTCTGCCAGAATATGGTCCATGGAGTGCTAACGCACGGATTCACATGTTCGACTACTGCAATTAACGACATGGACTTCCGCAACGTGTTGAGCGCCATGTTCCAAGGAGATGGAGATGCCTCGCCATTTAATGTCAAAGAACTGCGTCAAGTCCAAAGCCCTCGTGCTCGCTGTTCGCAATATTAGCTGCTGTGGAACGTGTCTTTCCCAAATGCTATGCAGACTTGGAGCCCATTGATTGGCCGGAGAATCCGTCGCAATTAATTCCACGGACCAGCAGAAGGCTTCAGAAGGCTTACATGGAGGCACCCA

Full Affymetrix probeset data:

Annotations for 1638410_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720