FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638411_at:

>probe:Drosophila_2:1638411_at:451:193; Interrogation_Position=1417; Antisense; AACTGCAGCTCTTCCAACTCAGATA
>probe:Drosophila_2:1638411_at:84:399; Interrogation_Position=1451; Antisense; GACATAAAAGACATCGCTCCGCACA
>probe:Drosophila_2:1638411_at:53:211; Interrogation_Position=1480; Antisense; AAGAATCTCTCGCAGTCCTTTAGTG
>probe:Drosophila_2:1638411_at:56:107; Interrogation_Position=1529; Antisense; AGACACAAGGTGGTGCGGGCTCCAT
>probe:Drosophila_2:1638411_at:15:115; Interrogation_Position=1560; Antisense; AGCAGAGCCACCATCGGTTGCGATG
>probe:Drosophila_2:1638411_at:508:361; Interrogation_Position=1590; Antisense; GCAAGGAGCCAGAATTCCGCTATAT
>probe:Drosophila_2:1638411_at:699:329; Interrogation_Position=1618; Antisense; GCGGACAGTGGCTTCAACGAGACTT
>probe:Drosophila_2:1638411_at:360:197; Interrogation_Position=1633; Antisense; AACGAGACTTCTAGCACGACCTTTG
>probe:Drosophila_2:1638411_at:701:77; Interrogation_Position=1667; Antisense; AGGATCTCCCGCTGGATGTGTCCAT
>probe:Drosophila_2:1638411_at:393:643; Interrogation_Position=1728; Antisense; TCTACCCTTCGCAGTTCTAGATGGT
>probe:Drosophila_2:1638411_at:621:53; Interrogation_Position=1785; Antisense; ATGCAATAACTCCTTTTCACAGCCA
>probe:Drosophila_2:1638411_at:280:549; Interrogation_Position=1817; Antisense; GGAGGACTTGTTTTTCAACTGCAAT
>probe:Drosophila_2:1638411_at:659:361; Interrogation_Position=1837; Antisense; GCAATGATCACCCACCGTTTATATA
>probe:Drosophila_2:1638411_at:701:217; Interrogation_Position=1915; Antisense; AAGTCGTGCGTTTATGTCATTTATA

Paste this into a BLAST search page for me
AACTGCAGCTCTTCCAACTCAGATAGACATAAAAGACATCGCTCCGCACAAAGAATCTCTCGCAGTCCTTTAGTGAGACACAAGGTGGTGCGGGCTCCATAGCAGAGCCACCATCGGTTGCGATGGCAAGGAGCCAGAATTCCGCTATATGCGGACAGTGGCTTCAACGAGACTTAACGAGACTTCTAGCACGACCTTTGAGGATCTCCCGCTGGATGTGTCCATTCTACCCTTCGCAGTTCTAGATGGTATGCAATAACTCCTTTTCACAGCCAGGAGGACTTGTTTTTCAACTGCAATGCAATGATCACCCACCGTTTATATAAAGTCGTGCGTTTATGTCATTTATA

Full Affymetrix probeset data:

Annotations for 1638411_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720