Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638412_at:

>probe:Drosophila_2:1638412_at:181:437; Interrogation_Position=6261; Antisense; GAGGAGACCCCAAAGATTCTAGACT
>probe:Drosophila_2:1638412_at:664:9; Interrogation_Position=6276; Antisense; ATTCTAGACTCGGACACGACTGCCA
>probe:Drosophila_2:1638412_at:612:171; Interrogation_Position=6327; Antisense; AAACAGCGGGCCAGGCTATCGGTAT
>probe:Drosophila_2:1638412_at:172:399; Interrogation_Position=6356; Antisense; GACACCGACTGCACCAAAGATCATG
>probe:Drosophila_2:1638412_at:450:105; Interrogation_Position=6392; Antisense; AGACACAGTGTCTACCTCGGGCGGG
>probe:Drosophila_2:1638412_at:283:531; Interrogation_Position=6415; Antisense; GGGTGACTTCCACAACCAGTGGCAC
>probe:Drosophila_2:1638412_at:649:609; Interrogation_Position=6496; Antisense; TGACCAGCGACGAGGTGTCCACCAG
>probe:Drosophila_2:1638412_at:670:625; Interrogation_Position=6536; Antisense; TGCCGAGCCCACCAGATGATGAATG
>probe:Drosophila_2:1638412_at:566:265; Interrogation_Position=6548; Antisense; CAGATGATGAATGGTCCCCTGGCGG
>probe:Drosophila_2:1638412_at:306:209; Interrogation_Position=6621; Antisense; AAGTCGCATCGGATCGGAACTAGTT
>probe:Drosophila_2:1638412_at:143:561; Interrogation_Position=6636; Antisense; GGAACTAGTTAACATCTACCTTCAG
>probe:Drosophila_2:1638412_at:541:697; Interrogation_Position=6682; Antisense; TTTAGTTGTTAGTCGAGCCTCTTAA
>probe:Drosophila_2:1638412_at:389:5; Interrogation_Position=6719; Antisense; ATTGTAATGTATTGCCAGCGCCGCT
>probe:Drosophila_2:1638412_at:480:123; Interrogation_Position=6735; Antisense; AGCGCCGCTTAGATCCAATTCTAAA

Paste this into a BLAST search page for me
GAGGAGACCCCAAAGATTCTAGACTATTCTAGACTCGGACACGACTGCCAAAACAGCGGGCCAGGCTATCGGTATGACACCGACTGCACCAAAGATCATGAGACACAGTGTCTACCTCGGGCGGGGGGTGACTTCCACAACCAGTGGCACTGACCAGCGACGAGGTGTCCACCAGTGCCGAGCCCACCAGATGATGAATGCAGATGATGAATGGTCCCCTGGCGGAAGTCGCATCGGATCGGAACTAGTTGGAACTAGTTAACATCTACCTTCAGTTTAGTTGTTAGTCGAGCCTCTTAAATTGTAATGTATTGCCAGCGCCGCTAGCGCCGCTTAGATCCAATTCTAAA

Full Affymetrix probeset data:

Annotations for 1638412_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime