FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638413_at:

>probe:Drosophila_2:1638413_at:711:379; Interrogation_Position=322; Antisense; GAACGGTGCCTACAGGCAGACCGTC
>probe:Drosophila_2:1638413_at:582:631; Interrogation_Position=345; Antisense; TCCGTCGCGACAACTTCATTAGCCA
>probe:Drosophila_2:1638413_at:428:577; Interrogation_Position=392; Antisense; GGCCGAGACATTGGTCTGATCCGCA
>probe:Drosophila_2:1638413_at:566:299; Interrogation_Position=420; Antisense; CCCATGTCGACTTCAACGGACTGAT
>probe:Drosophila_2:1638413_at:450:557; Interrogation_Position=437; Antisense; GGACTGATCAACAAGATCCCTCTGC
>probe:Drosophila_2:1638413_at:83:451; Interrogation_Position=451; Antisense; GATCCCTCTGCCAAGCATGAACGAG
>probe:Drosophila_2:1638413_at:557:613; Interrogation_Position=468; Antisense; TGAACGAGCAGAACGACCGCTACCA
>probe:Drosophila_2:1638413_at:394:399; Interrogation_Position=494; Antisense; GACACCTGGTGCGTCGCTTGCGGAT
>probe:Drosophila_2:1638413_at:728:639; Interrogation_Position=611; Antisense; TCGGTTGCCAGTACCGACATGTGCA
>probe:Drosophila_2:1638413_at:157:591; Interrogation_Position=687; Antisense; TGGTTACACACGACAATGCTCGTCT
>probe:Drosophila_2:1638413_at:531:233; Interrogation_Position=701; Antisense; AATGCTCGTCTCGTCGGTGTGATCA
>probe:Drosophila_2:1638413_at:95:299; Interrogation_Position=770; Antisense; CGCGTCTCGGACTACCTAGAATGGA
>probe:Drosophila_2:1638413_at:641:129; Interrogation_Position=783; Antisense; ACCTAGAATGGATCCGCGACCAGAC
>probe:Drosophila_2:1638413_at:683:435; Interrogation_Position=852; Antisense; GAGGATTCTTCAGCAAAGTCTTTGC

Paste this into a BLAST search page for me
GAACGGTGCCTACAGGCAGACCGTCTCCGTCGCGACAACTTCATTAGCCAGGCCGAGACATTGGTCTGATCCGCACCCATGTCGACTTCAACGGACTGATGGACTGATCAACAAGATCCCTCTGCGATCCCTCTGCCAAGCATGAACGAGTGAACGAGCAGAACGACCGCTACCAGACACCTGGTGCGTCGCTTGCGGATTCGGTTGCCAGTACCGACATGTGCATGGTTACACACGACAATGCTCGTCTAATGCTCGTCTCGTCGGTGTGATCACGCGTCTCGGACTACCTAGAATGGAACCTAGAATGGATCCGCGACCAGACGAGGATTCTTCAGCAAAGTCTTTGC

Full Affymetrix probeset data:

Annotations for 1638413_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720