FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638415_at:

>probe:Drosophila_2:1638415_at:36:91; Interrogation_Position=108; Antisense; AGTAGTTCCAATTGCTCCTGGTGAT
>probe:Drosophila_2:1638415_at:171:65; Interrogation_Position=152; Antisense; ATGGCCAAAAGGTCACGGTCCACTA
>probe:Drosophila_2:1638415_at:710:67; Interrogation_Position=194; Antisense; ATGGCACCAAGTTCGATTCGTCGCG
>probe:Drosophila_2:1638415_at:687:325; Interrogation_Position=218; Antisense; GCGACCGCAACAAGCCATTCAAGTT
>probe:Drosophila_2:1638415_at:40:13; Interrogation_Position=234; Antisense; ATTCAAGTTCACCATCGGCAAGGGC
>probe:Drosophila_2:1638415_at:202:429; Interrogation_Position=284; Antisense; GAGTTGCCCAGTTGAGCGTCGGCCA
>probe:Drosophila_2:1638415_at:188:205; Interrogation_Position=316; Antisense; AAGCTGATTTGCTCGCCGGACTATG
>probe:Drosophila_2:1638415_at:600:417; Interrogation_Position=403; Antisense; GAGCTGCTCAAGGTCGAATAGGCGC
>probe:Drosophila_2:1638415_at:8:681; Interrogation_Position=421; Antisense; TAGGCGCACAGGATGCCCAATGTGT
>probe:Drosophila_2:1638415_at:183:61; Interrogation_Position=440; Antisense; ATGTGTATACCCCAAACCAAATCGC
>probe:Drosophila_2:1638415_at:71:379; Interrogation_Position=516; Antisense; GAACCAGAACAATCCAGCAGCATTT
>probe:Drosophila_2:1638415_at:478:605; Interrogation_Position=559; Antisense; TGATAACTTCATACACAGCTCTAAA
>probe:Drosophila_2:1638415_at:712:699; Interrogation_Position=58; Antisense; TTTTCCGCTCGGTAATTTGCCAGAA
>probe:Drosophila_2:1638415_at:417:527; Interrogation_Position=606; Antisense; GGGAACGCATCTTCTACCAATACAA

Paste this into a BLAST search page for me
AGTAGTTCCAATTGCTCCTGGTGATATGGCCAAAAGGTCACGGTCCACTAATGGCACCAAGTTCGATTCGTCGCGGCGACCGCAACAAGCCATTCAAGTTATTCAAGTTCACCATCGGCAAGGGCGAGTTGCCCAGTTGAGCGTCGGCCAAAGCTGATTTGCTCGCCGGACTATGGAGCTGCTCAAGGTCGAATAGGCGCTAGGCGCACAGGATGCCCAATGTGTATGTGTATACCCCAAACCAAATCGCGAACCAGAACAATCCAGCAGCATTTTGATAACTTCATACACAGCTCTAAATTTTCCGCTCGGTAATTTGCCAGAAGGGAACGCATCTTCTACCAATACAA

Full Affymetrix probeset data:

Annotations for 1638415_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720