FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638416_at:

>probe:Drosophila_2:1638416_at:113:129; Interrogation_Position=123; Antisense; ACCATCAAGCGCAACCTGGCCGTTT
>probe:Drosophila_2:1638416_at:159:21; Interrogation_Position=13; Antisense; ATTTGTTTTAGGTTCCATCTCTATC
>probe:Drosophila_2:1638416_at:48:535; Interrogation_Position=167; Antisense; GGTGACCATCGCCTACAAAATTCTG
>probe:Drosophila_2:1638416_at:312:185; Interrogation_Position=183; Antisense; AAAATTCTGGTCAACGATCCCAAGA
>probe:Drosophila_2:1638416_at:149:621; Interrogation_Position=231; Antisense; TCGAAGTACGATGCCAACAAGTCCT
>probe:Drosophila_2:1638416_at:137:471; Interrogation_Position=24; Antisense; GTTCCATCTCTATCTCAGATTCTGA
>probe:Drosophila_2:1638416_at:145:311; Interrogation_Position=244; Antisense; CCAACAAGTCCTTCGAGCGCATGAA
>probe:Drosophila_2:1638416_at:156:613; Interrogation_Position=265; Antisense; TGAAGGCCGCCGGTCGTTTCCAGTC
>probe:Drosophila_2:1638416_at:491:503; Interrogation_Position=287; Antisense; GTCCTGCTAGGCTATGTTATCCCAA
>probe:Drosophila_2:1638416_at:294:161; Interrogation_Position=346; Antisense; ACAAGAGTTGCGCTTCTGTATTGAA
>probe:Drosophila_2:1638416_at:142:97; Interrogation_Position=379; Antisense; AGATTTCAGTCTACGTACGTGCACG
>probe:Drosophila_2:1638416_at:706:485; Interrogation_Position=393; Antisense; GTACGTGCACGAAGGCGTTTTAATT
>probe:Drosophila_2:1638416_at:374:101; Interrogation_Position=419; Antisense; AGAGCTATCTTGTATTGCCAGCAAA
>probe:Drosophila_2:1638416_at:495:721; Interrogation_Position=51; Antisense; TTGCAAATCGACATGGCCAACACTC

Paste this into a BLAST search page for me
ACCATCAAGCGCAACCTGGCCGTTTATTTGTTTTAGGTTCCATCTCTATCGGTGACCATCGCCTACAAAATTCTGAAAATTCTGGTCAACGATCCCAAGATCGAAGTACGATGCCAACAAGTCCTGTTCCATCTCTATCTCAGATTCTGACCAACAAGTCCTTCGAGCGCATGAATGAAGGCCGCCGGTCGTTTCCAGTCGTCCTGCTAGGCTATGTTATCCCAAACAAGAGTTGCGCTTCTGTATTGAAAGATTTCAGTCTACGTACGTGCACGGTACGTGCACGAAGGCGTTTTAATTAGAGCTATCTTGTATTGCCAGCAAATTGCAAATCGACATGGCCAACACTC

Full Affymetrix probeset data:

Annotations for 1638416_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720