FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638417_at:

>probe:Drosophila_2:1638417_at:581:669; Interrogation_Position=146; Antisense; TACGTCACTACGATTGCGTGGGCGT
>probe:Drosophila_2:1638417_at:344:521; Interrogation_Position=169; Antisense; GTGGCTGCGCCCCAAGTTGGAATAC
>probe:Drosophila_2:1638417_at:491:673; Interrogation_Position=191; Antisense; TACCGCTGCGTATTATCGTTATGGA
>probe:Drosophila_2:1638417_at:624:299; Interrogation_Position=23; Antisense; CGCCATATCGTCATTTTACCCAAAT
>probe:Drosophila_2:1638417_at:608:417; Interrogation_Position=262; Antisense; GAGCGTAAGATGTCCATACTGCCCT
>probe:Drosophila_2:1638417_at:567:725; Interrogation_Position=286; Antisense; TTGGCCGTCTTCATTAATCCGGAGC
>probe:Drosophila_2:1638417_at:263:253; Interrogation_Position=336; Antisense; CAAGCATCCCGAAGGTTGCATGAGT
>probe:Drosophila_2:1638417_at:376:57; Interrogation_Position=355; Antisense; ATGAGTGTGCGAGGCTATTCCGCTG
>probe:Drosophila_2:1638417_at:697:359; Interrogation_Position=419; Antisense; GCAAGCTGGGCACTCCGTCGGAAAT
>probe:Drosophila_2:1638417_at:145:547; Interrogation_Position=51; Antisense; GGATCCTGTTCTGCGCCAAAGGGCA
>probe:Drosophila_2:1638417_at:421:25; Interrogation_Position=515; Antisense; ATAGGATGGATCTCTCCACCTTCAA
>probe:Drosophila_2:1638417_at:125:713; Interrogation_Position=535; Antisense; TTCAACTGCATCCTCTGGGAGCAAA
>probe:Drosophila_2:1638417_at:232:119; Interrogation_Position=567; Antisense; AGCTGAAGGTCGATCCGCCATTTGG
>probe:Drosophila_2:1638417_at:536:449; Interrogation_Position=578; Antisense; GATCCGCCATTTGGTTTCACAAGTA

Paste this into a BLAST search page for me
TACGTCACTACGATTGCGTGGGCGTGTGGCTGCGCCCCAAGTTGGAATACTACCGCTGCGTATTATCGTTATGGACGCCATATCGTCATTTTACCCAAATGAGCGTAAGATGTCCATACTGCCCTTTGGCCGTCTTCATTAATCCGGAGCCAAGCATCCCGAAGGTTGCATGAGTATGAGTGTGCGAGGCTATTCCGCTGGCAAGCTGGGCACTCCGTCGGAAATGGATCCTGTTCTGCGCCAAAGGGCAATAGGATGGATCTCTCCACCTTCAATTCAACTGCATCCTCTGGGAGCAAAAGCTGAAGGTCGATCCGCCATTTGGGATCCGCCATTTGGTTTCACAAGTA

Full Affymetrix probeset data:

Annotations for 1638417_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720