FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638418_at:

>probe:Drosophila_2:1638418_at:68:213; Interrogation_Position=1087; Antisense; AAGACTCTGCCGGAGAGCCTCTATA
>probe:Drosophila_2:1638418_at:48:287; Interrogation_Position=1138; Antisense; CTGGACGCCCATGATAACTGTCTGG
>probe:Drosophila_2:1638418_at:612:195; Interrogation_Position=1153; Antisense; AACTGTCTGGGCACCGATGACTGCA
>probe:Drosophila_2:1638418_at:282:349; Interrogation_Position=1175; Antisense; GCAGTCACTACCACTTTATGCTGAT
>probe:Drosophila_2:1638418_at:541:333; Interrogation_Position=1194; Antisense; GCTGATCTTTGAAACGTCGGCGTGT
>probe:Drosophila_2:1638418_at:665:681; Interrogation_Position=1225; Antisense; TATGTGCCGCCGCAAATGTCCATGG
>probe:Drosophila_2:1638418_at:348:67; Interrogation_Position=1246; Antisense; ATGGCTATGGACAAACTCCTGGTGC
>probe:Drosophila_2:1638418_at:116:391; Interrogation_Position=1289; Antisense; GAAACCTAACCAATCTGGTGCCCAG
>probe:Drosophila_2:1638418_at:728:125; Interrogation_Position=1312; Antisense; AGCCACTCGTACATTAGCAGCCAGG
>probe:Drosophila_2:1638418_at:607:671; Interrogation_Position=1344; Antisense; TACGCCGCAGGACTTGATCATTCAC
>probe:Drosophila_2:1638418_at:39:491; Interrogation_Position=1398; Antisense; GTACAGGCGCTATTTCTGGTGGCAC
>probe:Drosophila_2:1638418_at:688:99; Interrogation_Position=1511; Antisense; AGAGATCCTACAGCTTGGGTTTCAT
>probe:Drosophila_2:1638418_at:460:529; Interrogation_Position=1527; Antisense; GGGTTTCATCAACTGGTGGACCAAA
>probe:Drosophila_2:1638418_at:486:255; Interrogation_Position=1629; Antisense; CAAATTGCCCTCGTTCGGTGTGGTT

Paste this into a BLAST search page for me
AAGACTCTGCCGGAGAGCCTCTATACTGGACGCCCATGATAACTGTCTGGAACTGTCTGGGCACCGATGACTGCAGCAGTCACTACCACTTTATGCTGATGCTGATCTTTGAAACGTCGGCGTGTTATGTGCCGCCGCAAATGTCCATGGATGGCTATGGACAAACTCCTGGTGCGAAACCTAACCAATCTGGTGCCCAGAGCCACTCGTACATTAGCAGCCAGGTACGCCGCAGGACTTGATCATTCACGTACAGGCGCTATTTCTGGTGGCACAGAGATCCTACAGCTTGGGTTTCATGGGTTTCATCAACTGGTGGACCAAACAAATTGCCCTCGTTCGGTGTGGTT

Full Affymetrix probeset data:

Annotations for 1638418_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720