Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638419_at:

>probe:Drosophila_2:1638419_at:101:189; Interrogation_Position=3347; Antisense; AACACCATCTGCAAGTCCTACAAGA
>probe:Drosophila_2:1638419_at:20:95; Interrogation_Position=3421; Antisense; AGATTCCTCCTTGGTCATGGTGGTA
>probe:Drosophila_2:1638419_at:364:537; Interrogation_Position=3433; Antisense; GGTCATGGTGGTATCCGAACCCGAC
>probe:Drosophila_2:1638419_at:394:513; Interrogation_Position=3471; Antisense; GTGTGGCCCTGGCAACCTAACCCAG
>probe:Drosophila_2:1638419_at:687:87; Interrogation_Position=3494; Antisense; AGTCGTTCCTCAATGGCCACAGATG
>probe:Drosophila_2:1638419_at:284:447; Interrogation_Position=3515; Antisense; GATGCCCGGATATCCAAATCAGTGG
>probe:Drosophila_2:1638419_at:368:163; Interrogation_Position=3530; Antisense; AAATCAGTGGCCACAATTACCAGGT
>probe:Drosophila_2:1638419_at:622:1; Interrogation_Position=3545; Antisense; ATTACCAGGTTATCCCCAGCAATTA
>probe:Drosophila_2:1638419_at:275:649; Interrogation_Position=3590; Antisense; TCAGTGGCCGTGGTCTTGGCCAAAA
>probe:Drosophila_2:1638419_at:269:497; Interrogation_Position=3602; Antisense; GTCTTGGCCAAAACCACCAGTAGTT
>probe:Drosophila_2:1638419_at:452:91; Interrogation_Position=3620; Antisense; AGTAGTTCAACCTGGCGACTGTGAA
>probe:Drosophila_2:1638419_at:260:191; Interrogation_Position=3645; Antisense; AACATATGCGAAAACCTACTGAAGG
>probe:Drosophila_2:1638419_at:76:451; Interrogation_Position=3687; Antisense; GATCTCATCAGAAGGTGCTTGTGCA
>probe:Drosophila_2:1638419_at:676:343; Interrogation_Position=3703; Antisense; GCTTGTGCACACGAACATAATCCTT

Paste this into a BLAST search page for me
AACACCATCTGCAAGTCCTACAAGAAGATTCCTCCTTGGTCATGGTGGTAGGTCATGGTGGTATCCGAACCCGACGTGTGGCCCTGGCAACCTAACCCAGAGTCGTTCCTCAATGGCCACAGATGGATGCCCGGATATCCAAATCAGTGGAAATCAGTGGCCACAATTACCAGGTATTACCAGGTTATCCCCAGCAATTATCAGTGGCCGTGGTCTTGGCCAAAAGTCTTGGCCAAAACCACCAGTAGTTAGTAGTTCAACCTGGCGACTGTGAAAACATATGCGAAAACCTACTGAAGGGATCTCATCAGAAGGTGCTTGTGCAGCTTGTGCACACGAACATAATCCTT

Full Affymetrix probeset data:

Annotations for 1638419_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime