FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638420_at:

>probe:Drosophila_2:1638420_at:701:581; Interrogation_Position=365; Antisense; TGGCGGCGGCCAGGAAATCAAAATC
>probe:Drosophila_2:1638420_at:228:37; Interrogation_Position=396; Antisense; ATCATCTCGCAGCAGGCTTCGTCTG
>probe:Drosophila_2:1638420_at:71:729; Interrogation_Position=485; Antisense; TTGGTCATCGGGTGGTGCTTCCAGC
>probe:Drosophila_2:1638420_at:181:535; Interrogation_Position=537; Antisense; GGTGCTGAAGCTGTGAAGATCATCA
>probe:Drosophila_2:1638420_at:498:453; Interrogation_Position=554; Antisense; GATCATCAAAATCATCTCGGAATCG
>probe:Drosophila_2:1638420_at:133:237; Interrogation_Position=574; Antisense; AATCGAATTCTGGAGCTGGAGACTC
>probe:Drosophila_2:1638420_at:450:719; Interrogation_Position=605; Antisense; TTGGTCGTCTGGTGGTTCATCCTAC
>probe:Drosophila_2:1638420_at:301:467; Interrogation_Position=742; Antisense; GTTGGTCCGCAGGTGGCTCATCCAG
>probe:Drosophila_2:1638420_at:174:47; Interrogation_Position=761; Antisense; ATCCAGCGGAGGTTGGGCTTCCCAG
>probe:Drosophila_2:1638420_at:274:283; Interrogation_Position=797; Antisense; CTGGTAATTGTGATAACCCGTGATT
>probe:Drosophila_2:1638420_at:672:459; Interrogation_Position=818; Antisense; GATTTTATTGTCTTCATTCCACCCA
>probe:Drosophila_2:1638420_at:196:39; Interrogation_Position=847; Antisense; ATCTCACATCCATTTCTCTGTTATG
>probe:Drosophila_2:1638420_at:221:303; Interrogation_Position=872; Antisense; CCCCACACCACCATATTTGTTAAAT
>probe:Drosophila_2:1638420_at:67:191; Interrogation_Position=899; Antisense; AACTTTTCTGTTTGATCATTTCCCA

Paste this into a BLAST search page for me
TGGCGGCGGCCAGGAAATCAAAATCATCATCTCGCAGCAGGCTTCGTCTGTTGGTCATCGGGTGGTGCTTCCAGCGGTGCTGAAGCTGTGAAGATCATCAGATCATCAAAATCATCTCGGAATCGAATCGAATTCTGGAGCTGGAGACTCTTGGTCGTCTGGTGGTTCATCCTACGTTGGTCCGCAGGTGGCTCATCCAGATCCAGCGGAGGTTGGGCTTCCCAGCTGGTAATTGTGATAACCCGTGATTGATTTTATTGTCTTCATTCCACCCAATCTCACATCCATTTCTCTGTTATGCCCCACACCACCATATTTGTTAAATAACTTTTCTGTTTGATCATTTCCCA

Full Affymetrix probeset data:

Annotations for 1638420_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720