FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638421_at:

>probe:Drosophila_2:1638421_at:594:73; Interrogation_Position=1091; Antisense; AGGACATAGTCCGTGGCTGTTTCAA
>probe:Drosophila_2:1638421_at:222:285; Interrogation_Position=1107; Antisense; CTGTTTCAAGATGCAGCCGGGCGAA
>probe:Drosophila_2:1638421_at:490:325; Interrogation_Position=1127; Antisense; GCGAAACTGCATCCGCGATTATCGT
>probe:Drosophila_2:1638421_at:77:311; Interrogation_Position=1157; Antisense; CCACAATCGTGATCATGGGCGCATT
>probe:Drosophila_2:1638421_at:36:691; Interrogation_Position=1184; Antisense; TATTCGGTGAGGTGCTTCTGCTGGA
>probe:Drosophila_2:1638421_at:624:83; Interrogation_Position=1216; Antisense; AGTGGCATCCTGAGCATCTGCATGT
>probe:Drosophila_2:1638421_at:373:147; Interrogation_Position=1258; Antisense; ACTAGTTCCACCTTCGGCATATTTA
>probe:Drosophila_2:1638421_at:186:87; Interrogation_Position=1290; Antisense; AGTGCTGGTTCCCTGGGCGAATACA
>probe:Drosophila_2:1638421_at:355:571; Interrogation_Position=1342; Antisense; GGCTTCCTCCTGACCGGATGGATAA
>probe:Drosophila_2:1638421_at:478:27; Interrogation_Position=1363; Antisense; ATAACTTTCGGGTCGCAAATTGCGG
>probe:Drosophila_2:1638421_at:259:217; Interrogation_Position=1434; Antisense; AAGTTGCCCCGGTAATGTGACTGCT
>probe:Drosophila_2:1638421_at:551:437; Interrogation_Position=1480; Antisense; GAGGAGCAGGTGTTTCCACTTTTCC
>probe:Drosophila_2:1638421_at:127:633; Interrogation_Position=1502; Antisense; TCCGACTCTCATTCCACTGGATAAA
>probe:Drosophila_2:1638421_at:317:693; Interrogation_Position=1614; Antisense; TTTGATATCTCCAGTGATCCACAGG

Paste this into a BLAST search page for me
AGGACATAGTCCGTGGCTGTTTCAACTGTTTCAAGATGCAGCCGGGCGAAGCGAAACTGCATCCGCGATTATCGTCCACAATCGTGATCATGGGCGCATTTATTCGGTGAGGTGCTTCTGCTGGAAGTGGCATCCTGAGCATCTGCATGTACTAGTTCCACCTTCGGCATATTTAAGTGCTGGTTCCCTGGGCGAATACAGGCTTCCTCCTGACCGGATGGATAAATAACTTTCGGGTCGCAAATTGCGGAAGTTGCCCCGGTAATGTGACTGCTGAGGAGCAGGTGTTTCCACTTTTCCTCCGACTCTCATTCCACTGGATAAATTTGATATCTCCAGTGATCCACAGG

Full Affymetrix probeset data:

Annotations for 1638421_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720