FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638424_at:

>probe:Drosophila_2:1638424_at:252:463; Interrogation_Position=1040; Antisense; GATTCTTTGCTTTGCATTCTACGGT
>probe:Drosophila_2:1638424_at:52:275; Interrogation_Position=1054; Antisense; CATTCTACGGTAGTGGTGCAGCCAG
>probe:Drosophila_2:1638424_at:518:499; Interrogation_Position=1069; Antisense; GTGCAGCCAGTTATGATTAGCCAGG
>probe:Drosophila_2:1638424_at:387:141; Interrogation_Position=1099; Antisense; ACGGATGCCTGTTTCAATGCCTTGA
>probe:Drosophila_2:1638424_at:626:415; Interrogation_Position=1135; Antisense; GAGCGTGGCATTCGGTTTAAGAACC
>probe:Drosophila_2:1638424_at:344:305; Interrogation_Position=1200; Antisense; CCTGGTTCCCTTCTTCGATAGAAAG
>probe:Drosophila_2:1638424_at:515:523; Interrogation_Position=1279; Antisense; GGGCTTCCACGTTTTATGTCTATAA
>probe:Drosophila_2:1638424_at:703:91; Interrogation_Position=738; Antisense; AGTTAATGTTCTGGCCCATGGCGAT
>probe:Drosophila_2:1638424_at:610:61; Interrogation_Position=818; Antisense; ATGTGCTGCTCATTGACTTCCAGTA
>probe:Drosophila_2:1638424_at:539:271; Interrogation_Position=874; Antisense; CATCACCTGTTCAATACTTCTCTAA
>probe:Drosophila_2:1638424_at:407:275; Interrogation_Position=890; Antisense; CTTCTCTAAAGGAGCCACTGCGTAG
>probe:Drosophila_2:1638424_at:249:427; Interrogation_Position=914; Antisense; GAGATCAGCAGAACGGGCTCTTCCA
>probe:Drosophila_2:1638424_at:590:337; Interrogation_Position=930; Antisense; GCTCTTCCAGTTCTACCACAAGATA
>probe:Drosophila_2:1638424_at:656:647; Interrogation_Position=993; Antisense; TCAGATTCCCAGTTTGCATCAGTTT

Paste this into a BLAST search page for me
GATTCTTTGCTTTGCATTCTACGGTCATTCTACGGTAGTGGTGCAGCCAGGTGCAGCCAGTTATGATTAGCCAGGACGGATGCCTGTTTCAATGCCTTGAGAGCGTGGCATTCGGTTTAAGAACCCCTGGTTCCCTTCTTCGATAGAAAGGGGCTTCCACGTTTTATGTCTATAAAGTTAATGTTCTGGCCCATGGCGATATGTGCTGCTCATTGACTTCCAGTACATCACCTGTTCAATACTTCTCTAACTTCTCTAAAGGAGCCACTGCGTAGGAGATCAGCAGAACGGGCTCTTCCAGCTCTTCCAGTTCTACCACAAGATATCAGATTCCCAGTTTGCATCAGTTT

Full Affymetrix probeset data:

Annotations for 1638424_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720