FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638425_at:

>probe:Drosophila_2:1638425_at:29:263; Interrogation_Position=1065; Antisense; CAGCGTGATGTTGCGCCCCAGTGAG
>probe:Drosophila_2:1638425_at:335:511; Interrogation_Position=1085; Antisense; GTGAGCCAGTCGCAGCTGACCACTG
>probe:Drosophila_2:1638425_at:300:671; Interrogation_Position=1138; Antisense; TACGATGACTCTGCCTTGTGTACAA
>probe:Drosophila_2:1638425_at:398:687; Interrogation_Position=1153; Antisense; TTGTGTACAACGTTTTCGGCCGGCA
>probe:Drosophila_2:1638425_at:154:639; Interrogation_Position=1168; Antisense; TCGGCCGGCACACATAGACGTTCAA
>probe:Drosophila_2:1638425_at:284:407; Interrogation_Position=1184; Antisense; GACGTTCAACGGATGAGCTTTACCT
>probe:Drosophila_2:1638425_at:279:419; Interrogation_Position=1198; Antisense; GAGCTTTACCTCGAACTAGAAATGA
>probe:Drosophila_2:1638425_at:338:219; Interrogation_Position=1232; Antisense; AAGTCATCAGCTGGTTCGTTGGCAA
>probe:Drosophila_2:1638425_at:603:471; Interrogation_Position=1245; Antisense; GTTCGTTGGCAATATTTCTACTAAG
>probe:Drosophila_2:1638425_at:337:89; Interrogation_Position=1268; Antisense; AGTCAGGGATCGCTTTAGGCTAGAA
>probe:Drosophila_2:1638425_at:46:27; Interrogation_Position=1296; Antisense; ATACGTTTTCTCTCTTATTTACTGC
>probe:Drosophila_2:1638425_at:662:705; Interrogation_Position=1390; Antisense; TTAGTTTGTATCTTTAGCCAACAGA
>probe:Drosophila_2:1638425_at:553:53; Interrogation_Position=1463; Antisense; ATGCAATATTGCCTAGCCATAAGCT
>probe:Drosophila_2:1638425_at:183:511; Interrogation_Position=1496; Antisense; GTGCAATTTTCGTATTTTAGCGTTA

Paste this into a BLAST search page for me
CAGCGTGATGTTGCGCCCCAGTGAGGTGAGCCAGTCGCAGCTGACCACTGTACGATGACTCTGCCTTGTGTACAATTGTGTACAACGTTTTCGGCCGGCATCGGCCGGCACACATAGACGTTCAAGACGTTCAACGGATGAGCTTTACCTGAGCTTTACCTCGAACTAGAAATGAAAGTCATCAGCTGGTTCGTTGGCAAGTTCGTTGGCAATATTTCTACTAAGAGTCAGGGATCGCTTTAGGCTAGAAATACGTTTTCTCTCTTATTTACTGCTTAGTTTGTATCTTTAGCCAACAGAATGCAATATTGCCTAGCCATAAGCTGTGCAATTTTCGTATTTTAGCGTTA

Full Affymetrix probeset data:

Annotations for 1638425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720