FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638426_at:

>probe:Drosophila_2:1638426_at:453:617; Interrogation_Position=389; Antisense; TGCAGCACCAGAACTCGTATGGCGC
>probe:Drosophila_2:1638426_at:257:15; Interrogation_Position=457; Antisense; ATCGTTTGCCAAACTCCAAGTTCGG
>probe:Drosophila_2:1638426_at:433:557; Interrogation_Position=480; Antisense; GGACTTCAACTACAGCAATCGACAG
>probe:Drosophila_2:1638426_at:239:261; Interrogation_Position=539; Antisense; CACCGCAATTCTATCAGCAGCAGGG
>probe:Drosophila_2:1638426_at:519:649; Interrogation_Position=552; Antisense; TCAGCAGCAGGGAGCGCCAGTGATC
>probe:Drosophila_2:1638426_at:150:557; Interrogation_Position=625; Antisense; GGACTGGCCCAGGATCAGATCGATT
>probe:Drosophila_2:1638426_at:713:95; Interrogation_Position=641; Antisense; AGATCGATTTCGTGGGCGTGCCGCT
>probe:Drosophila_2:1638426_at:265:281; Interrogation_Position=671; Antisense; CTCCGCAACCTAAATCCTATGTGAT
>probe:Drosophila_2:1638426_at:342:213; Interrogation_Position=707; Antisense; AAGAGGAGTTCGGTCCTTCGACAGC
>probe:Drosophila_2:1638426_at:191:535; Interrogation_Position=718; Antisense; GGTCCTTCGACAGCCGAGATTATAG
>probe:Drosophila_2:1638426_at:464:239; Interrogation_Position=745; Antisense; AATCAATCGCAGGACTACATCGACG
>probe:Drosophila_2:1638426_at:88:667; Interrogation_Position=760; Antisense; TACATCGACGAGAAGCTTGCCGAAT
>probe:Drosophila_2:1638426_at:461:339; Interrogation_Position=856; Antisense; GCATCCTCCGAATCTTTCGAATCAT
>probe:Drosophila_2:1638426_at:282:717; Interrogation_Position=871; Antisense; TTCGAATCATCGGAATCCGCCGTAT

Paste this into a BLAST search page for me
TGCAGCACCAGAACTCGTATGGCGCATCGTTTGCCAAACTCCAAGTTCGGGGACTTCAACTACAGCAATCGACAGCACCGCAATTCTATCAGCAGCAGGGTCAGCAGCAGGGAGCGCCAGTGATCGGACTGGCCCAGGATCAGATCGATTAGATCGATTTCGTGGGCGTGCCGCTCTCCGCAACCTAAATCCTATGTGATAAGAGGAGTTCGGTCCTTCGACAGCGGTCCTTCGACAGCCGAGATTATAGAATCAATCGCAGGACTACATCGACGTACATCGACGAGAAGCTTGCCGAATGCATCCTCCGAATCTTTCGAATCATTTCGAATCATCGGAATCCGCCGTAT

Full Affymetrix probeset data:

Annotations for 1638426_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720