FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638427_at:

>probe:Drosophila_2:1638427_at:603:255; Interrogation_Position=1299; Antisense; CAAACTGCATTTCACTGGACGGTAT
>probe:Drosophila_2:1638427_at:661:481; Interrogation_Position=1320; Antisense; GTATTGAGATTACCCTCGCACCTGG
>probe:Drosophila_2:1638427_at:246:593; Interrogation_Position=1342; Antisense; TGGTGTGGCCAAGTACCTCCTACTG
>probe:Drosophila_2:1638427_at:211:641; Interrogation_Position=1420; Antisense; TCTGGCGCTCACTTTGGTGGCGGAA
>probe:Drosophila_2:1638427_at:398:379; Interrogation_Position=1475; Antisense; GAACCGTACGGCGTGCTGGGCTACT
>probe:Drosophila_2:1638427_at:52:525; Interrogation_Position=1492; Antisense; GGGCTACTGGATTCAGGTCCTGATT
>probe:Drosophila_2:1638427_at:96:605; Interrogation_Position=1512; Antisense; TGATTCCCGATGAACTGGTGCCGCG
>probe:Drosophila_2:1638427_at:23:593; Interrogation_Position=1527; Antisense; TGGTGCCGCGCCTGATGGAAGACTT
>probe:Drosophila_2:1638427_at:494:587; Interrogation_Position=1596; Antisense; TGGAGCTCGAGTGGCCCGACAAGAA
>probe:Drosophila_2:1638427_at:9:379; Interrogation_Position=1624; Antisense; GAAGCTGATCATCGACCAGCCGGAA
>probe:Drosophila_2:1638427_at:322:411; Interrogation_Position=1670; Antisense; GACGCTGCTCCTCTGAAAATGTGAT
>probe:Drosophila_2:1638427_at:541:515; Interrogation_Position=1696; Antisense; GTGTCCATTGGTTAGCTAGTAGTTA
>probe:Drosophila_2:1638427_at:565:661; Interrogation_Position=1782; Antisense; TAACACAATGCACGTGGCCTTTGCT
>probe:Drosophila_2:1638427_at:214:635; Interrogation_Position=1809; Antisense; TCGCCGGAGTCCAGTCAAAATATAC

Paste this into a BLAST search page for me
CAAACTGCATTTCACTGGACGGTATGTATTGAGATTACCCTCGCACCTGGTGGTGTGGCCAAGTACCTCCTACTGTCTGGCGCTCACTTTGGTGGCGGAAGAACCGTACGGCGTGCTGGGCTACTGGGCTACTGGATTCAGGTCCTGATTTGATTCCCGATGAACTGGTGCCGCGTGGTGCCGCGCCTGATGGAAGACTTTGGAGCTCGAGTGGCCCGACAAGAAGAAGCTGATCATCGACCAGCCGGAAGACGCTGCTCCTCTGAAAATGTGATGTGTCCATTGGTTAGCTAGTAGTTATAACACAATGCACGTGGCCTTTGCTTCGCCGGAGTCCAGTCAAAATATAC

Full Affymetrix probeset data:

Annotations for 1638427_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720