FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638429_at:

>probe:Drosophila_2:1638429_at:235:237; Interrogation_Position=145; Antisense; AATCGAATTCAGAACGCCGTCTCAA
>probe:Drosophila_2:1638429_at:449:199; Interrogation_Position=157; Antisense; AACGCCGTCTCAAACAGAACCATTT
>probe:Drosophila_2:1638429_at:156:175; Interrogation_Position=16; Antisense; AAAGCCGTGTGCTTAGGCTTGGAAT
>probe:Drosophila_2:1638429_at:249:133; Interrogation_Position=193; Antisense; AACTTAGCCATCTGTAACTTCTTAA
>probe:Drosophila_2:1638429_at:31:309; Interrogation_Position=232; Antisense; TCCAAGGTTTACTCGGTGATCTATG
>probe:Drosophila_2:1638429_at:679:247; Interrogation_Position=270; Antisense; CAATTCCACGGTATTTAGATGCCCC
>probe:Drosophila_2:1638429_at:279:707; Interrogation_Position=284; Antisense; TTAGATGCCCCGTCCAGCCAAGTGT
>probe:Drosophila_2:1638429_at:593:127; Interrogation_Position=299; Antisense; AGCCAAGTGTCTACTACCTGAGCAA
>probe:Drosophila_2:1638429_at:416:373; Interrogation_Position=340; Antisense; GAAGTGCCCATTTTTCATCAACCTG
>probe:Drosophila_2:1638429_at:99:269; Interrogation_Position=355; Antisense; CATCAACCTGGAATGTTTCGATTAT
>probe:Drosophila_2:1638429_at:75:549; Interrogation_Position=402; Antisense; GGAGGGCAATATGCTCACAGAGCTC
>probe:Drosophila_2:1638429_at:510:339; Interrogation_Position=414; Antisense; GCTCACAGAGCTCATCTGGCGATAT
>probe:Drosophila_2:1638429_at:419:287; Interrogation_Position=429; Antisense; CTGGCGATATCGTGTTAGGCGTATA
>probe:Drosophila_2:1638429_at:275:403; Interrogation_Position=64; Antisense; GACTACTTTGGTTTAGTTCCAGGAG

Paste this into a BLAST search page for me
AATCGAATTCAGAACGCCGTCTCAAAACGCCGTCTCAAACAGAACCATTTAAAGCCGTGTGCTTAGGCTTGGAATAACTTAGCCATCTGTAACTTCTTAATCCAAGGTTTACTCGGTGATCTATGCAATTCCACGGTATTTAGATGCCCCTTAGATGCCCCGTCCAGCCAAGTGTAGCCAAGTGTCTACTACCTGAGCAAGAAGTGCCCATTTTTCATCAACCTGCATCAACCTGGAATGTTTCGATTATGGAGGGCAATATGCTCACAGAGCTCGCTCACAGAGCTCATCTGGCGATATCTGGCGATATCGTGTTAGGCGTATAGACTACTTTGGTTTAGTTCCAGGAG

Full Affymetrix probeset data:

Annotations for 1638429_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720