FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638431_at:

>probe:Drosophila_2:1638431_at:475:409; Interrogation_Position=400; Antisense; GACCCTTTAGACTTAACATGCCCGA
>probe:Drosophila_2:1638431_at:656:49; Interrogation_Position=417; Antisense; ATGCCCGACTTCTATGAACTCTTGA
>probe:Drosophila_2:1638431_at:481:613; Interrogation_Position=431; Antisense; TGAACTCTTGAATGTGCCATCCACG
>probe:Drosophila_2:1638431_at:676:309; Interrogation_Position=451; Antisense; CCACGGCCAGTTTCGATGAGATCAA
>probe:Drosophila_2:1638431_at:593:723; Interrogation_Position=492; Antisense; TTGATACTACAATGTCATCCCGACA
>probe:Drosophila_2:1638431_at:375:247; Interrogation_Position=517; Antisense; AATTGCGACAGCTCGATGACCCAAA
>probe:Drosophila_2:1638431_at:366:215; Interrogation_Position=604; Antisense; AAGATCCCATTAGGCGCAAGCACTA
>probe:Drosophila_2:1638431_at:570:193; Interrogation_Position=637; Antisense; AACTGCTGCAGTCGAAATTCCGGGC
>probe:Drosophila_2:1638431_at:487:247; Interrogation_Position=652; Antisense; AATTCCGGGCGCATAGCAACATCTA
>probe:Drosophila_2:1638431_at:191:645; Interrogation_Position=673; Antisense; TCTACGCCACCGTTGTGTTGAGTGA
>probe:Drosophila_2:1638431_at:234:229; Interrogation_Position=821; Antisense; AATGTGGAGCTACGCGTACGACTGC
>probe:Drosophila_2:1638431_at:433:649; Interrogation_Position=857; Antisense; TCAGTATCTGTTCGATGGACCCGCA
>probe:Drosophila_2:1638431_at:332:409; Interrogation_Position=882; Antisense; GACGATGATGAGTCACCCGAAGTGA
>probe:Drosophila_2:1638431_at:127:433; Interrogation_Position=912; Antisense; GAGTGCAACGAGTGCTCTTTAGTGA

Paste this into a BLAST search page for me
GACCCTTTAGACTTAACATGCCCGAATGCCCGACTTCTATGAACTCTTGATGAACTCTTGAATGTGCCATCCACGCCACGGCCAGTTTCGATGAGATCAATTGATACTACAATGTCATCCCGACAAATTGCGACAGCTCGATGACCCAAAAAGATCCCATTAGGCGCAAGCACTAAACTGCTGCAGTCGAAATTCCGGGCAATTCCGGGCGCATAGCAACATCTATCTACGCCACCGTTGTGTTGAGTGAAATGTGGAGCTACGCGTACGACTGCTCAGTATCTGTTCGATGGACCCGCAGACGATGATGAGTCACCCGAAGTGAGAGTGCAACGAGTGCTCTTTAGTGA

Full Affymetrix probeset data:

Annotations for 1638431_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720