FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638433_at:

>probe:Drosophila_2:1638433_at:272:127; Interrogation_Position=319; Antisense; ACCTTCAGGCGTAAGAATATTCCTC
>probe:Drosophila_2:1638433_at:213:493; Interrogation_Position=329; Antisense; GTAAGAATATTCCTCACCTCGCCAG
>probe:Drosophila_2:1638433_at:525:125; Interrogation_Position=352; Antisense; AGCCGCATTGCTGGAGTAGCTCATC
>probe:Drosophila_2:1638433_at:521:721; Interrogation_Position=359; Antisense; TTGCTGGAGTAGCTCATCCGCTTGA
>probe:Drosophila_2:1638433_at:128:47; Interrogation_Position=374; Antisense; ATCCGCTTGACCTTCCTGAATGTGG
>probe:Drosophila_2:1638433_at:175:611; Interrogation_Position=381; Antisense; TGACCTTCCTGAATGTGGCATCGTT
>probe:Drosophila_2:1638433_at:712:229; Interrogation_Position=392; Antisense; AATGTGGCATCGTTCTCCGCCTGGG
>probe:Drosophila_2:1638433_at:296:595; Interrogation_Position=413; Antisense; TGGGCCAGAGCCCTTTCCAGCGCAT
>probe:Drosophila_2:1638433_at:464:629; Interrogation_Position=428; Antisense; TCCAGCGCATTGTCCATCTGGGCAT
>probe:Drosophila_2:1638433_at:704:39; Interrogation_Position=443; Antisense; ATCTGGGCATCACGCTCGTCCAGGC
>probe:Drosophila_2:1638433_at:47:651; Interrogation_Position=452; Antisense; TCACGCTCGTCCAGGCCGTGATAGA
>probe:Drosophila_2:1638433_at:493:629; Interrogation_Position=461; Antisense; TCCAGGCCGTGATAGAGGGCGCCAC
>probe:Drosophila_2:1638433_at:133:359; Interrogation_Position=497; Antisense; GCAAAATAGAAAATGGGCGTGGCGT
>probe:Drosophila_2:1638433_at:78:331; Interrogation_Position=513; Antisense; GCGTGGCGTGGCAAACAAGTGTTAA

Paste this into a BLAST search page for me
ACCTTCAGGCGTAAGAATATTCCTCGTAAGAATATTCCTCACCTCGCCAGAGCCGCATTGCTGGAGTAGCTCATCTTGCTGGAGTAGCTCATCCGCTTGAATCCGCTTGACCTTCCTGAATGTGGTGACCTTCCTGAATGTGGCATCGTTAATGTGGCATCGTTCTCCGCCTGGGTGGGCCAGAGCCCTTTCCAGCGCATTCCAGCGCATTGTCCATCTGGGCATATCTGGGCATCACGCTCGTCCAGGCTCACGCTCGTCCAGGCCGTGATAGATCCAGGCCGTGATAGAGGGCGCCACGCAAAATAGAAAATGGGCGTGGCGTGCGTGGCGTGGCAAACAAGTGTTAA

Full Affymetrix probeset data:

Annotations for 1638433_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720