FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638436_at:

>probe:Drosophila_2:1638436_at:120:299; Interrogation_Position=467; Antisense; CGCCGCAGGGCCAGGAATTCGATTT
>probe:Drosophila_2:1638436_at:502:363; Interrogation_Position=481; Antisense; GAATTCGATTTGGACACCATGCCGC
>probe:Drosophila_2:1638436_at:281:13; Interrogation_Position=515; Antisense; ATTACCTGCTCCTTCAAAAGCTACG
>probe:Drosophila_2:1638436_at:601:115; Interrogation_Position=598; Antisense; AGCATTGACTCCTGGCGACTACTGG
>probe:Drosophila_2:1638436_at:511:41; Interrogation_Position=664; Antisense; ATCGGCGGGCAGTTCATGCAGCGCA
>probe:Drosophila_2:1638436_at:76:395; Interrogation_Position=696; Antisense; GAAATCGGTGCCGTTCAAGCCACGC
>probe:Drosophila_2:1638436_at:631:255; Interrogation_Position=726; Antisense; CAAACGTGCTCAAGTGTGCGGTGGC
>probe:Drosophila_2:1638436_at:332:623; Interrogation_Position=742; Antisense; TGCGGTGGCGATTGAGTCACGACAA
>probe:Drosophila_2:1638436_at:609:151; Interrogation_Position=777; Antisense; ACATGGCACGGCACGGAATCGGACT
>probe:Drosophila_2:1638436_at:287:71; Interrogation_Position=845; Antisense; AGGCGACTGGCCCTTGAGTTAACAT
>probe:Drosophila_2:1638436_at:368:655; Interrogation_Position=880; Antisense; TAATGGCCAGCTGAATTCGACGCGA
>probe:Drosophila_2:1638436_at:555:411; Interrogation_Position=898; Antisense; GACGCGACGCAAAAATAATCCACAT
>probe:Drosophila_2:1638436_at:244:369; Interrogation_Position=934; Antisense; GAATGACTACTCTACTAGTTACTAG
>probe:Drosophila_2:1638436_at:265:707; Interrogation_Position=952; Antisense; TTACTAGCGCTATAACCCTGATTTG

Paste this into a BLAST search page for me
CGCCGCAGGGCCAGGAATTCGATTTGAATTCGATTTGGACACCATGCCGCATTACCTGCTCCTTCAAAAGCTACGAGCATTGACTCCTGGCGACTACTGGATCGGCGGGCAGTTCATGCAGCGCAGAAATCGGTGCCGTTCAAGCCACGCCAAACGTGCTCAAGTGTGCGGTGGCTGCGGTGGCGATTGAGTCACGACAAACATGGCACGGCACGGAATCGGACTAGGCGACTGGCCCTTGAGTTAACATTAATGGCCAGCTGAATTCGACGCGAGACGCGACGCAAAAATAATCCACATGAATGACTACTCTACTAGTTACTAGTTACTAGCGCTATAACCCTGATTTG

Full Affymetrix probeset data:

Annotations for 1638436_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720