FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638437_at:

>probe:Drosophila_2:1638437_at:568:419; Interrogation_Position=118; Antisense; GAGCAGATCGCTCACTTGATAAAGA
>probe:Drosophila_2:1638437_at:397:51; Interrogation_Position=13; Antisense; ATGCGCATCTTTCTACTTTCTAAGG
>probe:Drosophila_2:1638437_at:76:593; Interrogation_Position=153; Antisense; TGTGTTGTTTATCAAGGATCCCGAT
>probe:Drosophila_2:1638437_at:402:297; Interrogation_Position=173; Antisense; CCGATAACAAGGGACTGGAGCAGGC
>probe:Drosophila_2:1638437_at:194:45; Interrogation_Position=235; Antisense; ATCGCCATTTACGTGCTCAACAAGC
>probe:Drosophila_2:1638437_at:95:191; Interrogation_Position=265; Antisense; AACATTGGCAAGTGGATCACCAACC
>probe:Drosophila_2:1638437_at:168:127; Interrogation_Position=283; Antisense; ACCAACCTGAATACTATCCGTAACA
>probe:Drosophila_2:1638437_at:430:695; Interrogation_Position=29; Antisense; TTTCTAAGGCTATAGCACCCGCCAG
>probe:Drosophila_2:1638437_at:405:249; Interrogation_Position=306; Antisense; CAACAACAAAAACCGCAAGCCCGAG
>probe:Drosophila_2:1638437_at:548:359; Interrogation_Position=320; Antisense; GCAAGCCCGAGGTTCACTTTGTGAA
>probe:Drosophila_2:1638437_at:88:123; Interrogation_Position=52; Antisense; AGCGAGTTCACCAAGGAGTTCTTCA
>probe:Drosophila_2:1638437_at:573:93; Interrogation_Position=68; Antisense; AGTTCTTCACCTACAGTGCTCCAGA
>probe:Drosophila_2:1638437_at:710:619; Interrogation_Position=84; Antisense; TGCTCCAGAGCACGAATTTGATGAC
>probe:Drosophila_2:1638437_at:473:19; Interrogation_Position=99; Antisense; ATTTGATGACCACCCCAACGAGCAG

Paste this into a BLAST search page for me
GAGCAGATCGCTCACTTGATAAAGAATGCGCATCTTTCTACTTTCTAAGGTGTGTTGTTTATCAAGGATCCCGATCCGATAACAAGGGACTGGAGCAGGCATCGCCATTTACGTGCTCAACAAGCAACATTGGCAAGTGGATCACCAACCACCAACCTGAATACTATCCGTAACATTTCTAAGGCTATAGCACCCGCCAGCAACAACAAAAACCGCAAGCCCGAGGCAAGCCCGAGGTTCACTTTGTGAAAGCGAGTTCACCAAGGAGTTCTTCAAGTTCTTCACCTACAGTGCTCCAGATGCTCCAGAGCACGAATTTGATGACATTTGATGACCACCCCAACGAGCAG

Full Affymetrix probeset data:

Annotations for 1638437_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720