FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638440_at:

>probe:Drosophila_2:1638440_at:4:241; Interrogation_Position=1054; Antisense; AATCACGTGGCAAGTCGCAGGCGAA
>probe:Drosophila_2:1638440_at:442:105; Interrogation_Position=1074; Antisense; GCGAAAAACCTCTCCGTTCAAATGG
>probe:Drosophila_2:1638440_at:728:473; Interrogation_Position=1089; Antisense; GTTCAAATGGTTGCCGCCGAGAAGC
>probe:Drosophila_2:1638440_at:62:423; Interrogation_Position=1107; Antisense; GAGAAGCTAGCCCAATGTCCACCGG
>probe:Drosophila_2:1638440_at:393:61; Interrogation_Position=1121; Antisense; ATGTCCACCGGATATGTTCGATGTA
>probe:Drosophila_2:1638440_at:649:237; Interrogation_Position=1158; Antisense; AATCAGCTGGAAGACGCCTGCGAGC
>probe:Drosophila_2:1638440_at:239:385; Interrogation_Position=1200; Antisense; GAGACGTATTGGAAGGCCACCCACC
>probe:Drosophila_2:1638440_at:214:155; Interrogation_Position=1320; Antisense; ACACCGGGTGTTGTGCGCCTGTAAA
>probe:Drosophila_2:1638440_at:365:459; Interrogation_Position=1368; Antisense; GATTTCTCACATTCTTCCGGGTGTT
>probe:Drosophila_2:1638440_at:85:291; Interrogation_Position=1385; Antisense; CGGGTGTTTTCCTAGATCAGCTCAA
>probe:Drosophila_2:1638440_at:354:677; Interrogation_Position=1397; Antisense; TAGATCAGCTCAACTCAACCCAAAT
>probe:Drosophila_2:1638440_at:115:57; Interrogation_Position=1458; Antisense; ATGTATTCCGTTATTGTCGAACCTT
>probe:Drosophila_2:1638440_at:494:499; Interrogation_Position=1473; Antisense; GTCGAACCTTATGTTTTCACCATTT
>probe:Drosophila_2:1638440_at:578:675; Interrogation_Position=1539; Antisense; TAGAGGAACCTCTTACCAGCACAGC

Paste this into a BLAST search page for me
AATCACGTGGCAAGTCGCAGGCGAAGCGAAAAACCTCTCCGTTCAAATGGGTTCAAATGGTTGCCGCCGAGAAGCGAGAAGCTAGCCCAATGTCCACCGGATGTCCACCGGATATGTTCGATGTAAATCAGCTGGAAGACGCCTGCGAGCGAGACGTATTGGAAGGCCACCCACCACACCGGGTGTTGTGCGCCTGTAAAGATTTCTCACATTCTTCCGGGTGTTCGGGTGTTTTCCTAGATCAGCTCAATAGATCAGCTCAACTCAACCCAAATATGTATTCCGTTATTGTCGAACCTTGTCGAACCTTATGTTTTCACCATTTTAGAGGAACCTCTTACCAGCACAGC

Full Affymetrix probeset data:

Annotations for 1638440_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720