FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638442_at:

>probe:Drosophila_2:1638442_at:428:375; Interrogation_Position=1026; Antisense; GAAGCAAGCCATGTACCATCTAACG
>probe:Drosophila_2:1638442_at:57:59; Interrogation_Position=1061; Antisense; ATGATGCTTATGCTGAGCCTGGTCA
>probe:Drosophila_2:1638442_at:416:125; Interrogation_Position=1076; Antisense; AGCCTGGTCAGGATAGTCGCAATAT
>probe:Drosophila_2:1638442_at:361:547; Interrogation_Position=1131; Antisense; GGATGTTCAGGATCAGCCGCCAGTG
>probe:Drosophila_2:1638442_at:646:83; Interrogation_Position=1173; Antisense; AGTGACCAAACTGCCACCGGGAATA
>probe:Drosophila_2:1638442_at:360:259; Interrogation_Position=1187; Antisense; CACCGGGAATACTGCCAGGCGATAA
>probe:Drosophila_2:1638442_at:652:215; Interrogation_Position=1210; Antisense; AAGATATTGCAAGTCCACGCCGAGG
>probe:Drosophila_2:1638442_at:516:471; Interrogation_Position=1261; Antisense; GTTCGCTACGGCTTGGTATCCGAGA
>probe:Drosophila_2:1638442_at:583:483; Interrogation_Position=1276; Antisense; GTATCCGAGAACAATCCGTTCACCT
>probe:Drosophila_2:1638442_at:511:473; Interrogation_Position=1293; Antisense; GTTCACCTCGTTTTTCGACATCAAC
>probe:Drosophila_2:1638442_at:702:469; Interrogation_Position=938; Antisense; GTTCTCCGCTATTTGCCATAAGACA
>probe:Drosophila_2:1638442_at:721:183; Interrogation_Position=964; Antisense; AAAATCGTATCTTCCGAGACCACAG
>probe:Drosophila_2:1638442_at:466:423; Interrogation_Position=979; Antisense; GAGACCACAGAAGGCACCGTTTTCC
>probe:Drosophila_2:1638442_at:604:701; Interrogation_Position=998; Antisense; TTTTCCTCCTGGGACCATTAGATTT

Paste this into a BLAST search page for me
GAAGCAAGCCATGTACCATCTAACGATGATGCTTATGCTGAGCCTGGTCAAGCCTGGTCAGGATAGTCGCAATATGGATGTTCAGGATCAGCCGCCAGTGAGTGACCAAACTGCCACCGGGAATACACCGGGAATACTGCCAGGCGATAAAAGATATTGCAAGTCCACGCCGAGGGTTCGCTACGGCTTGGTATCCGAGAGTATCCGAGAACAATCCGTTCACCTGTTCACCTCGTTTTTCGACATCAACGTTCTCCGCTATTTGCCATAAGACAAAAATCGTATCTTCCGAGACCACAGGAGACCACAGAAGGCACCGTTTTCCTTTTCCTCCTGGGACCATTAGATTT

Full Affymetrix probeset data:

Annotations for 1638442_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720